\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619240761:

Variant ID: vg0619240761 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19240761
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATCTACTCGATCAGCTGTAGATATTAACAATATATAATCTTTATGTCGATATATATTTAAATCAAGTGATTGGGATAGATCGGTTGCCATGCCGAGA[C/T]
AGTATAAATTACTTAGATCGAAATATATATTAACAAACAAGATTATATATGTTCATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTC

Reverse complement sequence

GAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATGAACATATATAATCTTGTTTGTTAATATATATTTCGATCTAAGTAATTTATACT[G/A]
TCTCGGCATGGCAACCGATCTATCCCAATCACTTGATTTAAATATATATCGACATAAAGATTATATATTGTTAATATCTACAGCTGATCGAGTAGATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 5.40% 2.71% 3.94% NA
All Indica  2759 87.90% 8.40% 3.44% 0.18% NA
All Japonica  1512 85.40% 0.90% 1.92% 11.77% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 91.90% 0.00% 7.39% 0.67% NA
Indica II  465 84.70% 10.80% 4.52% 0.00% NA
Indica III  913 85.10% 14.10% 0.77% 0.00% NA
Indica Intermediate  786 90.10% 6.90% 2.93% 0.13% NA
Temperate Japonica  767 78.00% 1.30% 2.09% 18.64% NA
Tropical Japonica  504 97.20% 0.40% 0.20% 2.18% NA
Japonica Intermediate  241 84.60% 0.40% 4.98% 9.96% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 84.40% 10.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619240761 C -> T LOC_Os06g33040-LOC_Os06g33050 intergenic_region ; MODIFIER silent_mutation Average:31.746; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0619240761 C -> DEL N N silent_mutation Average:31.746; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619240761 NA 7.43E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 1.16E-06 5.28E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 NA 2.89E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 7.98E-07 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 7.46E-07 3.03E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 3.53E-07 6.26E-09 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 3.79E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 7.76E-07 2.51E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619240761 1.25E-06 NA mr1244_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251