| Variant ID: vg0619240761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19240761 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
TAAATCTACTCGATCAGCTGTAGATATTAACAATATATAATCTTTATGTCGATATATATTTAAATCAAGTGATTGGGATAGATCGGTTGCCATGCCGAGA[C/T]
AGTATAAATTACTTAGATCGAAATATATATTAACAAACAAGATTATATATGTTCATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTC
GAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATGAACATATATAATCTTGTTTGTTAATATATATTTCGATCTAAGTAATTTATACT[G/A]
TCTCGGCATGGCAACCGATCTATCCCAATCACTTGATTTAAATATATATCGACATAAAGATTATATATTGTTAATATCTACAGCTGATCGAGTAGATTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 5.40% | 2.71% | 3.94% | NA |
| All Indica | 2759 | 87.90% | 8.40% | 3.44% | 0.18% | NA |
| All Japonica | 1512 | 85.40% | 0.90% | 1.92% | 11.77% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.90% | 0.00% | 7.39% | 0.67% | NA |
| Indica II | 465 | 84.70% | 10.80% | 4.52% | 0.00% | NA |
| Indica III | 913 | 85.10% | 14.10% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 6.90% | 2.93% | 0.13% | NA |
| Temperate Japonica | 767 | 78.00% | 1.30% | 2.09% | 18.64% | NA |
| Tropical Japonica | 504 | 97.20% | 0.40% | 0.20% | 2.18% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.40% | 4.98% | 9.96% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 10.00% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619240761 | C -> T | LOC_Os06g33040-LOC_Os06g33050 | intergenic_region ; MODIFIER | silent_mutation | Average:31.746; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0619240761 | C -> DEL | N | N | silent_mutation | Average:31.746; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619240761 | NA | 7.43E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 1.16E-06 | 5.28E-09 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | NA | 2.89E-09 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 7.98E-07 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 7.46E-07 | 3.03E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 3.53E-07 | 6.26E-09 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 3.79E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 7.76E-07 | 2.51E-10 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619240761 | 1.25E-06 | NA | mr1244_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |