\
| Variant ID: vg0619155361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19155361 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.08, others allele: 0.00, population size: 232. )
ACAGTGCAGCCCATCTACCTTCTCATGCCCTCAAGGAGACCAAAGAAGCCCTAGGTCTCCTTGACACAAAAGATAAGGAAGTTCCTATGGGCGGGGACAA[G/C]
GGCCATCACAGGGGGGAAATGCATGATTAACTGGAAAAAGACGTGCATCCCAACCACACCAGGAGGACTGGGAGTTCTCAATATGCAGAAGTTCATGAGG
CCTCATGAACTTCTGCATATTGAGAACTCCCAGTCCTCCTGGTGTGGTTGGGATGCACGTCTTTTTCCAGTTAATCATGCATTTCCCCCCTGTGATGGCC[C/G]
TTGTCCCCGCCCATAGGAACTTCCTTATCTTTTGTGTCAAGGAGACCTAGGGCTTCTTTGGTCTCCTTGAGGGCATGAGAAGGTAGATGGGCTGCACTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 42.10% | 0.21% | 1.50% | NA |
| All Indica | 2759 | 88.50% | 11.00% | 0.11% | 0.40% | NA |
| All Japonica | 1512 | 3.60% | 92.60% | 0.26% | 3.57% | NA |
| Aus | 269 | 42.80% | 57.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 5.90% | 0.17% | 1.01% | NA |
| Indica II | 465 | 94.60% | 5.20% | 0.00% | 0.22% | NA |
| Indica III | 913 | 91.30% | 8.30% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 78.10% | 21.50% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 4.60% | 91.30% | 0.26% | 3.91% | NA |
| Tropical Japonica | 504 | 1.80% | 96.80% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 4.10% | 88.00% | 0.83% | 7.05% | NA |
| VI/Aromatic | 96 | 5.20% | 90.60% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 43.30% | 51.10% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619155361 | G -> C | LOC_Os06g32900.1 | missense_variant ; p.Lys927Asn; MODERATE | nonsynonymous_codon ; K927N | Average:56.462; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0619155361 | G -> DEL | LOC_Os06g32900.1 | N | frameshift_variant | Average:56.462; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619155361 | NA | 6.02E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 5.05E-08 | mr1043_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 1.68E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 3.13E-07 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 5.55E-07 | mr1185_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | 2.50E-06 | 2.70E-09 | mr1269_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 3.14E-07 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 8.38E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 9.99E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | 8.33E-06 | 2.00E-08 | mr1479_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 1.25E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 8.92E-06 | mr1638_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | 6.21E-06 | 7.52E-08 | mr1677_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 7.98E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 7.30E-08 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 2.65E-07 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 3.05E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619155361 | NA | 1.75E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |