\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619101816:

Variant ID: vg0619101816 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19101816
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCCATGCCTCAGGACGATGACTGGTTCTGGGGGCGCCCGACTCCCGTCGTCGTCGGCGACGGCGAGACGACGTCGAAGCCAAAGCCGCCGGTGGCGGG[A/G]
AAGACGAAGAAGGTGGAGGAGCAGCACCCACGGCGACCGGGGGAGCCGGACTGCAGCTACTACGTCAAGTTCGGGAGCTGCAAGTTCGGCATCAGCTGCG

Reverse complement sequence

CGCAGCTGATGCCGAACTTGCAGCTCCCGAACTTGACGTAGTAGCTGCAGTCCGGCTCCCCCGGTCGCCGTGGGTGCTGCTCCTCCACCTTCTTCGTCTT[T/C]
CCCGCCACCGGCGGCTTTGGCTTCGACGTCGTCTCGCCGTCGCCGACGACGACGGGAGTCGGGCGCCCCCAGAACCAGTCATCGTCCTGAGGCATGGAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 12.60% 4.82% 1.21% NA
All Indica  2759 98.90% 0.40% 0.69% 0.04% NA
All Japonica  1512 45.00% 38.00% 13.56% 3.37% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.20% 1.85% 0.17% NA
Indica II  465 99.10% 0.40% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.90% 0.76% 0.00% NA
Temperate Japonica  767 17.30% 60.00% 19.30% 3.39% NA
Tropical Japonica  504 84.70% 8.10% 5.95% 1.19% NA
Japonica Intermediate  241 50.20% 30.70% 11.20% 7.88% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 84.40% 10.00% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619101816 A -> G LOC_Os06g32860.1 synonymous_variant ; p.Gly32Gly; LOW synonymous_codon Average:69.992; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0619101816 A -> G LOC_Os06g32860.2 synonymous_variant ; p.Gly32Gly; LOW synonymous_codon Average:69.992; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0619101816 A -> DEL LOC_Os06g32860.2 N frameshift_variant Average:69.992; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0619101816 A -> DEL LOC_Os06g32860.1 N frameshift_variant Average:69.992; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619101816 NA 4.22E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 3.05E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 5.28E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.58E-07 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 8.04E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.40E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 2.34E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.41E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 1.10E-06 NA mr1330 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 2.45E-06 9.74E-10 mr1330 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.96E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 5.02E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 4.58E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 7.55E-06 mr1707 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 1.19E-06 1.91E-10 mr1748 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 5.87E-08 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 4.01E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.12E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 9.68E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 4.30E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.50E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 2.13E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619101816 NA 1.59E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251