Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0618988041:

Variant ID: vg0618988041 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18988041
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTAATAAAACTTAAAAACATAAATTTATATGATTTTGTAAAATAATTTTCCTATAGATTTTTTTTAGAAAAATATTGTTTAGCAGTTAGGGAAAGGTG[C/T,G]
GTACGAAAAATAAGGGAATACGCGCTGGGAAAAGGGATATAGAACACAACTACTGTCTGCGTGAATGAATTAATTGTATCGATTATTTGAAAACACAGCC

Reverse complement sequence

GGCTGTGTTTTCAAATAATCGATACAATTAATTCATTCACGCAGACAGTAGTTGTGTTCTATATCCCTTTTCCCAGCGCGTATTCCCTTATTTTTCGTAC[G/A,C]
CACCTTTCCCTAACTGCTAAACAATATTTTTCTAAAAAAAATCTATAGGAAAATTATTTTACAAAATCATATAAATTTATGTTTTTAAGTTTTATTAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 8.10% 1.86% 2.05% G: 0.11%
All Indica  2759 83.20% 13.60% 2.83% 0.22% G: 0.14%
All Japonica  1512 94.00% 0.20% 0.20% 5.56% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 90.90% 3.00% 5.21% 0.84% NA
Indica II  465 88.60% 8.00% 3.44% 0.00% NA
Indica III  913 74.60% 23.90% 1.10% 0.00% G: 0.44%
Indica Intermediate  786 84.20% 13.00% 2.67% 0.13% NA
Temperate Japonica  767 92.60% 0.40% 0.39% 6.65% NA
Tropical Japonica  504 98.00% 0.00% 0.00% 1.98% NA
Japonica Intermediate  241 90.50% 0.00% 0.00% 9.54% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 86.70% 4.40% 4.44% 3.33% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618988041 C -> G LOC_Os06g32650.1 downstream_gene_variant ; 2098.0bp to feature; MODIFIER silent_mutation Average:60.026; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0618988041 C -> G LOC_Os06g32650-LOC_Os06g32660 intergenic_region ; MODIFIER silent_mutation Average:60.026; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0618988041 C -> T LOC_Os06g32650.1 downstream_gene_variant ; 2098.0bp to feature; MODIFIER silent_mutation Average:60.026; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0618988041 C -> T LOC_Os06g32650-LOC_Os06g32660 intergenic_region ; MODIFIER silent_mutation Average:60.026; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0618988041 C -> DEL N N silent_mutation Average:60.026; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618988041 3.50E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 6.80E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.49E-06 NA mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.35E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.33E-06 2.21E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 3.63E-07 NA mr1096 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.81E-06 1.38E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 7.12E-06 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.21E-07 NA mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.25E-08 4.57E-11 mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.10E-07 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.84E-09 NA mr1065_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 3.71E-07 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.44E-09 NA mr1068_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.11E-07 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 6.40E-09 NA mr1078_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 5.64E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 6.24E-12 3.13E-09 mr1087_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 7.65E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 3.08E-10 2.49E-08 mr1090_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 3.82E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.18E-08 NA mr1091_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.67E-08 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.18E-08 NA mr1094_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.10E-07 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.64E-09 1.53E-06 mr1096_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.84E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 3.38E-07 NA mr1108_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.22E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 5.12E-06 NA mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.02E-08 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 7.96E-11 3.51E-07 mr1111_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 8.40E-07 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.77E-07 NA mr1112_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.20E-06 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.79E-08 5.24E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 7.51E-08 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 6.60E-11 1.71E-07 mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.46E-07 NA mr1200_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.51E-07 NA mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.12E-07 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.27E-08 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 1.13E-07 NA mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 2.77E-07 NA mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618988041 4.45E-06 2.44E-07 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251