\
| Variant ID: vg0618978160 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18978160 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.02, others allele: 0.00, population size: 254. )
CATGTTGCCGATGCATGGTCCTGTGCATGCTGGTGATCACGTGTCATCGTATCATTTGTCGGCCATGTTGCCATTCACAGCCTTGTTGAATTTGGTTGTT[G/C]
ATGATGTCGCCGGTGGCGAAGACGATGCAACCCGCCCGACTAGTTGACGATGACGGCGCGGCCGCGCGGGCACAGGCCCGTGCACAAGTCTGGCAGCAGC
GCTGCTGCCAGACTTGTGCACGGGCCTGTGCCCGCGCGGCCGCGCCGTCATCGTCAACTAGTCGGGCGGGTTGCATCGTCTTCGCCACCGGCGACATCAT[C/G]
AACAACCAAATTCAACAAGGCTGTGAATGGCAACATGGCCGACAAATGATACGATGACACGTGATCACCAGCATGCACAGGACCATGCATCGGCAACATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.10% | 45.60% | 0.72% | 5.59% | NA |
| All Indica | 2759 | 75.80% | 19.60% | 0.43% | 4.17% | NA |
| All Japonica | 1512 | 2.60% | 91.90% | 1.12% | 4.37% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.80% | 19.30% | 1.01% | 0.84% | NA |
| Indica II | 465 | 92.00% | 6.50% | 0.22% | 1.29% | NA |
| Indica III | 913 | 69.40% | 21.70% | 0.11% | 8.76% | NA |
| Indica Intermediate | 786 | 71.20% | 25.20% | 0.51% | 3.05% | NA |
| Temperate Japonica | 767 | 3.80% | 89.20% | 1.96% | 5.08% | NA |
| Tropical Japonica | 504 | 0.80% | 98.20% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 2.90% | 87.10% | 0.41% | 9.54% | NA |
| VI/Aromatic | 96 | 4.20% | 19.80% | 2.08% | 73.96% | NA |
| Intermediate | 90 | 42.20% | 41.10% | 3.33% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618978160 | G -> C | LOC_Os06g32630.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.755; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| vg0618978160 | G -> DEL | N | N | silent_mutation | Average:65.755; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618978160 | NA | 9.55E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 4.45E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 1.65E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 3.91E-08 | mr1398 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 2.87E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 3.86E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 6.64E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 2.48E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 8.92E-10 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 5.96E-06 | mr1269_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 7.12E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 7.18E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 8.17E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 1.72E-06 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618978160 | NA | 2.61E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |