\
| Variant ID: vg0618926527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18926527 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )
AATTCTTAAAGAGGTATGATTTGGAGGGCTGTCCCATCATGAAAGCTTTATATGATATCAGGGAGAAGTGGGTGCCTGCGTTCTTCAGGAAGGACTACTG[C/T]
GGGAGGATGACGTCCACGCAGCGCAGTGAGAGCATGAACAAGTTGGTGAAGCACAAGTTTGTTGACTAGCAAACTACGCTCCACCGTTTTGCTAGGAGAA
TTCTCCTAGCAAAACGGTGGAGCGTAGTTTGCTAGTCAACAAACTTGTGCTTCACCAACTTGTTCATGCTCTCACTGCGCTGCGTGGACGTCATCCTCCC[G/A]
CAGTAGTCCTTCCTGAAGAACGCAGGCACCCACTTCTCCCTGATATCATATAAAGCTTTCATGATGGGACAGCCCTCCAAATCATACCTCTTTAAGAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 19.80% | 8.78% | 0.32% | NA |
| All Indica | 2759 | 63.70% | 22.10% | 14.14% | 0.00% | NA |
| All Japonica | 1512 | 78.00% | 20.50% | 0.60% | 0.93% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 36.50% | 36.80% | 26.72% | 0.00% | NA |
| Indica II | 465 | 35.90% | 39.10% | 24.95% | 0.00% | NA |
| Indica III | 913 | 96.80% | 2.10% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 62.30% | 24.30% | 13.36% | 0.00% | NA |
| Temperate Japonica | 767 | 66.60% | 30.60% | 0.91% | 1.83% | NA |
| Tropical Japonica | 504 | 96.00% | 3.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.30% | 23.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 16.70% | 13.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618926527 | C -> T | LOC_Os06g32530.1 | synonymous_variant ; p.Cys340Cys; LOW | synonymous_codon | Average:43.442; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg0618926527 | C -> DEL | LOC_Os06g32530.1 | N | frameshift_variant | Average:43.442; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618926527 | NA | 6.96E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0618926527 | 2.36E-06 | 9.71E-09 | mr1197 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | 2.96E-06 | 2.96E-06 | mr1197 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 2.07E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 7.39E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 3.05E-10 | mr1346_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 2.86E-07 | mr1359_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 8.35E-08 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 1.33E-08 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 8.09E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 3.86E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 2.51E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 9.88E-07 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 3.38E-07 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 7.21E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 9.79E-06 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 7.55E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 1.77E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 6.48E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 2.69E-07 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 6.70E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 3.17E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 5.27E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 4.99E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618926527 | NA | 9.64E-08 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |