\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618522104:

Variant ID: vg0618522104 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18522104
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.31, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGCTTGTTTATGTGCTGTTTTGGTGTTTTGCTCCTTTCT[A/G]
TTTAGATTCCGACATTTCCGGAGAGTCCGTTTTCGCAGCAGAAGAATTTGAAGAGTTCCAAGGCCAGCAAGGCAAGTCACACAGATCCCAAACAACCCTT

Reverse complement sequence

AAGGGTTGTTTGGGATCTGTGTGACTTGCCTTGCTGGCCTTGGAACTCTTCAAATTCTTCTGCTGCGAAAACGGACTCTCCGGAAATGTCGGAATCTAAA[T/C]
AGAAAGGAGCAAAACACCAAAACAGCACATAAACAAGCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 32.20% 2.12% 0.36% NA
All Indica  2759 90.20% 8.70% 0.62% 0.54% NA
All Japonica  1512 12.80% 82.10% 5.03% 0.13% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 82.00% 16.30% 1.51% 0.17% NA
Indica II  465 89.00% 10.30% 0.65% 0.00% NA
Indica III  913 97.90% 1.50% 0.00% 0.55% NA
Indica Intermediate  786 88.00% 10.20% 0.64% 1.15% NA
Temperate Japonica  767 13.60% 79.90% 6.26% 0.26% NA
Tropical Japonica  504 12.70% 84.10% 3.17% 0.00% NA
Japonica Intermediate  241 10.40% 84.60% 4.98% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 56.70% 36.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618522104 A -> G LOC_Os06g31880.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:16.012; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg0618522104 A -> G LOC_Os06g31870.1 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:16.012; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg0618522104 A -> G LOC_Os06g31890.1 downstream_gene_variant ; 2557.0bp to feature; MODIFIER silent_mutation Average:16.012; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg0618522104 A -> DEL N N silent_mutation Average:16.012; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618522104 NA 2.86E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 5.49E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 1.06E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 9.59E-06 3.71E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 3.49E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 4.78E-11 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 4.19E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 3.48E-07 1.86E-12 mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 7.19E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 1.04E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 1.18E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 7.43E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 9.41E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 4.66E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 2.01E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 2.04E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 2.12E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 5.49E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 1.19E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618522104 NA 7.58E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251