Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618477957:

Variant ID: vg0618477957 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18477957
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGATAGGATCCCTCCTTCTATAGATGGAGGGCCACTTAATCTAATCCTAACAAACCCTAAGCCTATCCAATGGGCCTAGGACGCCCGGCCTAAAGCCCA[T/G]
GACATTACTCCCCTCTTTTTGAGCAGCTCGTCCTCGAGGAATTAAATCCCTGTCCAGGAATCAGCCAGGGCACACAAAATGATAAATTAATATACAGATA

Reverse complement sequence

TATCTGTATATTAATTTATCATTTTGTGTGCCCTGGCTGATTCCTGGACAGGGATTTAATTCCTCGAGGACGAGCTGCTCAAAAAGAGGGGAGTAATGTC[A/C]
TGGGCTTTAGGCCGGGCGTCCTAGGCCCATTGGATAGGCTTAGGGTTTGTTAGGATTAGATTAAGTGGCCCTCCATCTATAGAAGGAGGGATCCTATCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	40.50%	0.53%	0.06%	NA
All Indica	2759	85.90%	13.60%	0.54%	0.00%	NA
All Japonica	1512	7.50%	91.90%	0.46%	0.20%	NA
Aus	269	94.80%	4.80%	0.37%	0.00%	NA
Indica I	595	74.50%	24.70%	0.84%	0.00%	NA
Indica II	465	86.20%	13.30%	0.43%	0.00%	NA
Indica III	913	96.50%	3.30%	0.22%	0.00%	NA
Indica Intermediate	786	81.90%	17.30%	0.76%	0.00%	NA
Temperate Japonica	767	5.20%	93.70%	0.65%	0.39%	NA
Tropical Japonica	504	12.10%	87.90%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	94.20%	0.83%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618477957	T -> G	LOC_Os06g31820.1	missense_variant ; p.Met40Leu; MODERATE	nonsynonymous_codon ; M40L	Average:7.816; most accessible tissue: Callus, score: 13.92	unknown	unknown	TOLERATED	0.92
vg0618477957	T -> DEL	LOC_Os06g31820.1	N	frameshift_variant	Average:7.816; most accessible tissue: Callus, score: 13.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618477957	NA	2.89E-75	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	7.00E-16	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.64E-21	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	3.70E-39	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	2.66E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	9.43E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.06E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	6.60E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	8.90E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.36E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.39E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.68E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	5.77E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.02E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.95E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	4.85E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	3.11E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.77E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	6.03E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	4.98E-06	NA	mr1829	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	9.13E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.25E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	8.91E-09	6.11E-97	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	1.01E-08	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	3.67E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618477957	NA	4.03E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251