\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618236227:

Variant ID: vg0618236227 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18236227
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGATCCTATATATTCGTGAGGGGCGTGACCGGCGGAGGCATTGCATCACGTGAGAAACCCTAGCCGTCACTTCCCTCCCCGAGCAAAACCCTAGCCGC[A/G]
CGCGGGTGCTAGCACATCTGCGCGTGGTGTTCCATCCCTGTACGTGTGGATACTAGTAGAGGCGTCGCTGGTTTGTGGTGCTGATTGGCGTGGGAGTACG

Reverse complement sequence

CGTACTCCCACGCCAATCAGCACCACAAACCAGCGACGCCTCTACTAGTATCCACACGTACAGGGATGGAACACCACGCGCAGATGTGCTAGCACCCGCG[T/C]
GCGGCTAGGGTTTTGCTCGGGGAGGGAAGTGACGGCTAGGGTTTCTCACGTGATGCAATGCCTCCGCCGGTCACGCCCCTCACGAATATATAGGATCCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.70% 2.50% 8.65% 44.14% NA
All Indica  2759 26.50% 0.90% 8.74% 63.86% NA
All Japonica  1512 74.90% 0.20% 8.86% 16.07% NA
Aus  269 74.00% 0.70% 5.20% 20.07% NA
Indica I  595 36.10% 0.80% 8.91% 54.12% NA
Indica II  465 23.40% 0.90% 7.10% 68.60% NA
Indica III  913 16.90% 1.10% 7.34% 74.70% NA
Indica Intermediate  786 32.10% 0.90% 11.20% 55.85% NA
Temperate Japonica  767 67.00% 0.10% 10.43% 22.43% NA
Tropical Japonica  504 86.10% 0.00% 3.57% 10.32% NA
Japonica Intermediate  241 76.30% 0.80% 14.94% 7.88% NA
VI/Aromatic  96 2.10% 85.40% 9.38% 3.12% NA
Intermediate  90 54.40% 6.70% 12.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618236227 A -> G LOC_Os06g31340.1 downstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:11.045; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0618236227 A -> G LOC_Os06g31320-LOC_Os06g31340 intergenic_region ; MODIFIER silent_mutation Average:11.045; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0618236227 A -> DEL N N silent_mutation Average:11.045; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618236227 NA 7.45E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618236227 NA 9.53E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 2.88E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 5.34E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 5.32E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 9.84E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 5.84E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 8.17E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 1.65E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 4.28E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 1.61E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 3.12E-11 mr1624_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 4.05E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 7.66E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 1.06E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 5.79E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 7.01E-07 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 2.43E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 5.55E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227 NA 3.41E-08 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251