Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618236227:

Variant ID: vg0618236227 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18236227
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGATCCTATATATTCGTGAGGGGCGTGACCGGCGGAGGCATTGCATCACGTGAGAAACCCTAGCCGTCACTTCCCTCCCCGAGCAAAACCCTAGCCGC[A/G]
CGCGGGTGCTAGCACATCTGCGCGTGGTGTTCCATCCCTGTACGTGTGGATACTAGTAGAGGCGTCGCTGGTTTGTGGTGCTGATTGGCGTGGGAGTACG

Reverse complement sequence

CGTACTCCCACGCCAATCAGCACCACAAACCAGCGACGCCTCTACTAGTATCCACACGTACAGGGATGGAACACCACGCGCAGATGTGCTAGCACCCGCG[T/C]
GCGGCTAGGGTTTTGCTCGGGGAGGGAAGTGACGGCTAGGGTTTCTCACGTGATGCAATGCCTCCGCCGGTCACGCCCCTCACGAATATATAGGATCCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.70%	2.50%	8.65%	44.14%	NA
All Indica	2759	26.50%	0.90%	8.74%	63.86%	NA
All Japonica	1512	74.90%	0.20%	8.86%	16.07%	NA
Aus	269	74.00%	0.70%	5.20%	20.07%	NA
Indica I	595	36.10%	0.80%	8.91%	54.12%	NA
Indica II	465	23.40%	0.90%	7.10%	68.60%	NA
Indica III	913	16.90%	1.10%	7.34%	74.70%	NA
Indica Intermediate	786	32.10%	0.90%	11.20%	55.85%	NA
Temperate Japonica	767	67.00%	0.10%	10.43%	22.43%	NA
Tropical Japonica	504	86.10%	0.00%	3.57%	10.32%	NA
Japonica Intermediate	241	76.30%	0.80%	14.94%	7.88%	NA
VI/Aromatic	96	2.10%	85.40%	9.38%	3.12%	NA
Intermediate	90	54.40%	6.70%	12.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618236227	A -> G	LOC_Os06g31340.1	downstream_gene_variant ; 1867.0bp to feature; MODIFIER	silent_mutation	Average:11.045; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0618236227	A -> G	LOC_Os06g31320-LOC_Os06g31340	intergenic_region ; MODIFIER	silent_mutation	Average:11.045; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0618236227	A -> DEL	N	N	silent_mutation	Average:11.045; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618236227	NA	7.45E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618236227	NA	9.53E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	2.88E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	5.34E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	5.32E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	9.84E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	5.84E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	8.17E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	1.65E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	4.28E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	1.61E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	3.12E-11	mr1624_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	4.05E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	7.66E-08	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	1.06E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	5.79E-07	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	7.01E-07	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	2.43E-07	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	5.55E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618236227	NA	3.41E-08	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251