| Variant ID: vg0618224048 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18224048 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACGAGCGGGGGATGCCCTTTTTCAAGCTATTGAAGAAAACAGACAACTTCCAGTAGCGACCCGAAGCACAAAAAGCCTTTCAAGCCTTCAAAAAACTCCT[T/C]
ACTACTCCACCAGTCTTAGCTTCACCGCATCCGCAAGAGCCGCTGTTGTTATATGTATCGACAACTTCCTAGGTCGTAAGCACAATCCTGGTTGTTGAGC
GCTCAACAACCAGGATTGTGCTTACGACCTAGGAAGTTGTCGATACATATAACAACAGCGGCTCTTGCGGATGCGGTGAAGCTAAGACTGGTGGAGTAGT[A/G]
AGGAGTTTTTTGAAGGCTTGAAAGGCTTTTTGTGCTTCGGGTCGCTACTGGAAGTTGTCTGTTTTCTTCAATAGCTTGAAAAAGGGCATCCCCCGCTCGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 10.90% | 1.69% | 55.18% | NA |
| All Indica | 2759 | 13.40% | 2.80% | 2.83% | 80.97% | NA |
| All Japonica | 1512 | 72.90% | 21.60% | 0.07% | 5.42% | NA |
| Aus | 269 | 4.10% | 0.40% | 0.37% | 95.17% | NA |
| Indica I | 595 | 22.70% | 4.70% | 2.52% | 70.08% | NA |
| Indica II | 465 | 16.80% | 1.10% | 1.08% | 81.08% | NA |
| Indica III | 913 | 2.80% | 1.50% | 2.08% | 93.54% | NA |
| Indica Intermediate | 786 | 16.50% | 3.90% | 4.96% | 74.55% | NA |
| Temperate Japonica | 767 | 64.40% | 33.00% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 84.90% | 3.40% | 0.20% | 11.51% | NA |
| Japonica Intermediate | 241 | 75.10% | 23.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 0.00% | 96.90% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 44.40% | 18.90% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618224048 | T -> C | LOC_Os06g31320.1 | upstream_gene_variant ; 4792.0bp to feature; MODIFIER | silent_mutation | Average:7.732; most accessible tissue: Callus, score: 34.536 | N | N | N | N |
| vg0618224048 | T -> C | LOC_Os06g31310.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.732; most accessible tissue: Callus, score: 34.536 | N | N | N | N |
| vg0618224048 | T -> DEL | N | N | silent_mutation | Average:7.732; most accessible tissue: Callus, score: 34.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618224048 | 3.00E-06 | NA | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 3.54E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | 6.10E-06 | NA | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 5.93E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 8.17E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 1.29E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 2.49E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 2.81E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618224048 | NA | 7.38E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |