\
| Variant ID: vg0618222588 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18222588 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAGCTTCGCAGATCCCTCGTCGATGGCGGCAGTGCACTCAACATCCTCTTCGCCAATACCTTGGACGACATGCAGATCCCTCGCACAGAATTAAAACCG[A/T]
GTAATGCGCCCTTTCACGGAGTCATTCCAGGGCTATCCGCTACGCCACTCGGCCAGATCACTCTTCCGGTTACTTTTGGTACTCGGGAGAACTTCCGCAC
GTGCGGAAGTTCTCCCGAGTACCAAAAGTAACCGGAAGAGTGATCTGGCCGAGTGGCGTAGCGGATAGCCCTGGAATGACTCCGTGAAAGGGCGCATTAC[T/A]
CGGTTTTAATTCTGTGCGAGGGATCTGCATGTCGTCCAAGGTATTGGCGAAGAGGATGTTGAGTGCACTGCCGCCATCGACGAGGGATCTGCGAAGCTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.40% | 4.30% | 10.33% | 27.02% | NA |
| All Indica | 2759 | 44.40% | 0.40% | 14.86% | 40.34% | NA |
| All Japonica | 1512 | 80.40% | 12.60% | 2.91% | 4.10% | NA |
| Aus | 269 | 58.40% | 0.00% | 10.04% | 31.60% | NA |
| Indica I | 595 | 46.90% | 1.70% | 12.10% | 39.33% | NA |
| Indica II | 465 | 45.20% | 0.00% | 14.19% | 40.65% | NA |
| Indica III | 913 | 40.90% | 0.00% | 18.18% | 40.96% | NA |
| Indica Intermediate | 786 | 46.10% | 0.30% | 13.49% | 40.20% | NA |
| Temperate Japonica | 767 | 73.40% | 20.60% | 4.43% | 1.56% | NA |
| Tropical Japonica | 504 | 89.10% | 0.00% | 1.79% | 9.13% | NA |
| Japonica Intermediate | 241 | 84.60% | 13.30% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 5.56% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618222588 | A -> T | LOC_Os06g31310.1 | missense_variant ; p.Ser708Cys; MODERATE | nonsynonymous_codon ; S708C | Average:11.305; most accessible tissue: Callus, score: 22.485 | probably damaging |
3.151 |
DELETERIOUS | 0.00 |
| vg0618222588 | A -> DEL | LOC_Os06g31310.1 | N | frameshift_variant | Average:11.305; most accessible tissue: Callus, score: 22.485 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618222588 | NA | 1.06E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 9.89E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 4.67E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 5.43E-06 | mr1126_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 5.17E-06 | mr1346_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | 2.64E-06 | 1.53E-07 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | 4.55E-06 | 2.70E-09 | mr1456_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 3.94E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 7.47E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 4.23E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 4.17E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222588 | NA | 5.16E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |