\
| Variant ID: vg0618222432 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18222432 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.02, others allele: 0.00, population size: 103. )
GCTGACCGAACGGGAGATTAACGTTGTTCAGCCCGATACACCCCAATATCTTCGGTGGTCGGAGACAACAATTAAGTTTGACCGCTCGGATCATCTAGAC[G/C,T]
AAGTGGTCCACCTGGGGCGGTACCCCCTGGTACTAGACCCAGTGGTTCGCAACGTCAAGCTTCGCAGATCCCTCGTCGATGGCGGCAGTGCACTCAACAT
ATGTTGAGTGCACTGCCGCCATCGACGAGGGATCTGCGAAGCTTGACGTTGCGAACCACTGGGTCTAGTACCAGGGGGTACCGCCCCAGGTGGACCACTT[C/G,A]
GTCTAGATGATCCGAGCGGTCAAACTTAATTGTTGTCTCCGACCACCGAAGATATTGGGGTGTATCGGGCTGAACAACGTTAATCTCCCGTTCGGTCAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.80% | 11.60% | 4.38% | 53.20% | T: 0.02% |
| All Indica | 2759 | 11.30% | 4.00% | 5.94% | 78.72% | T: 0.04% |
| All Japonica | 1512 | 72.60% | 21.60% | 0.20% | 5.62% | NA |
| Aus | 269 | 3.70% | 0.40% | 13.38% | 82.53% | NA |
| Indica I | 595 | 20.70% | 6.10% | 9.24% | 64.03% | NA |
| Indica II | 465 | 14.00% | 1.30% | 11.18% | 73.55% | NA |
| Indica III | 913 | 2.40% | 2.00% | 1.31% | 94.30% | NA |
| Indica Intermediate | 786 | 13.00% | 6.40% | 5.73% | 74.81% | T: 0.13% |
| Temperate Japonica | 767 | 64.30% | 33.00% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 84.30% | 3.40% | 0.20% | 12.10% | NA |
| Japonica Intermediate | 241 | 74.30% | 23.70% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 0.00% | 96.90% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 41.10% | 18.90% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618222432 | G -> C | LOC_Os06g31310.1 | missense_variant ; p.Glu656Gln; MODERATE | nonsynonymous_codon ; E656Q | Average:12.109; most accessible tissue: Callus, score: 29.181 | benign |
-0.721 |
DELETERIOUS | 0.04 |
| vg0618222432 | G -> T | LOC_Os06g31310.1 | stop_gained ; p.Glu656*; HIGH | stop_gained | Average:12.109; most accessible tissue: Callus, score: 29.181 | N | N | N | N |
| vg0618222432 | G -> DEL | LOC_Os06g31310.1 | N | frameshift_variant | Average:12.109; most accessible tissue: Callus, score: 29.181 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618222432 | NA | 5.32E-19 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0618222432 | NA | 4.45E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 1.43E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 7.02E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 2.73E-08 | mr1884 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 1.93E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 9.57E-06 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 1.25E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 4.47E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 1.11E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 6.59E-07 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618222432 | NA | 3.35E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |