| Variant ID: vg0618179900 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18179900 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 281. )
ACTCTTCTTCTTGCTTAACTCAGGTGCGTCCTTGGCTGGTTTTTTCTCTCCCCCTGTCTTCGGCTTGTCGTTCTTGCATCTCAGGGCATCGTCCGCATGA[G/T]
CGCAACGATCGACAATCTCGAATAGCTTGCGAGCAGTCGTGATTCGTCTTGTCGCCAACTCCTGGGTGGTGTAGCAATCTCGGACACCGGATTTGAAAGC
GCTTTCAAATCCGGTGTCCGAGATTGCTACACCACCCAGGAGTTGGCGACAAGACGAATCACGACTGCTCGCAAGCTATTCGAGATTGTCGATCGTTGCG[C/A]
TCATGCGGACGATGCCCTGAGATGCAAGAACGACAAGCCGAAGACAGGGGGAGAGAAAAAACCAGCCAAGGACGCACCTGAGTTAAGCAAGAAGAAGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.10% | 7.50% | 0.28% | 6.14% | NA |
| All Indica | 2759 | 88.50% | 11.30% | 0.07% | 0.11% | NA |
| All Japonica | 1512 | 79.50% | 0.80% | 0.73% | 18.98% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.60% | 13.10% | 0.00% | 0.34% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.70% | 16.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.30% | 10.40% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 76.50% | 0.10% | 1.17% | 22.16% | NA |
| Tropical Japonica | 504 | 93.70% | 2.00% | 0.20% | 4.17% | NA |
| Japonica Intermediate | 241 | 59.30% | 0.40% | 0.41% | 39.83% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618179900 | G -> T | LOC_Os06g31250.1 | missense_variant ; p.Ala437Asp; MODERATE | nonsynonymous_codon ; A437D | Average:56.42; most accessible tissue: Minghui63 young leaf, score: 76.82 | possibly damaging |
1.909 |
DELETERIOUS | 0.00 |
| vg0618179900 | G -> DEL | LOC_Os06g31250.1 | N | frameshift_variant | Average:56.42; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618179900 | NA | 4.56E-07 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 5.91E-08 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 2.97E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 3.12E-09 | mr1912 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 7.57E-07 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 6.26E-07 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 4.35E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 7.35E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 5.89E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618179900 | NA | 1.36E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |