\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618125723:

Variant ID: vg0618125723 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18125723
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTGAACTATAAAAGGAGGACCTGTCACACCCTAAAAATCCCAAATATATAAATTGTTGTCTAAATTGGAATTATTAGAATTTATTTTAAAAGCCTAAA[A/G]
GAGAAGATCTAGTTTTAATTAATAAATTCCAATATAAAATGGGGCCAGATAAAATTTCATTAAATACTTTGCTTAATTCTATAATTCCTAGATTTTTCTG

Reverse complement sequence

CAGAAAAATCTAGGAATTATAGAATTAAGCAAAGTATTTAATGAAATTTTATCTGGCCCCATTTTATATTGGAATTTATTAATTAAAACTAGATCTTCTC[T/C]
TTTAGGCTTTTAAAATAAATTCTAATAATTCCAATTTAGACAACAATTTATATATTTGGGATTTTTAGGGTGTGACAGGTCCTCCTTTTATAGTTCAAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 2.00% 29.14% 32.61% NA
All Indica  2759 5.40% 3.10% 40.05% 51.50% NA
All Japonica  1512 93.90% 0.40% 3.90% 1.79% NA
Aus  269 1.90% 1.10% 72.49% 24.54% NA
Indica I  595 3.50% 2.40% 31.09% 63.03% NA
Indica II  465 5.40% 1.30% 20.43% 72.90% NA
Indica III  913 5.10% 4.80% 58.71% 31.33% NA
Indica Intermediate  786 7.00% 2.70% 36.77% 53.56% NA
Temperate Japonica  767 96.60% 0.00% 0.52% 2.87% NA
Tropical Japonica  504 87.70% 1.00% 10.91% 0.40% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 53.30% 1.10% 16.67% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618125723 A -> G LOC_Os06g31190.1 upstream_gene_variant ; 4500.0bp to feature; MODIFIER silent_mutation Average:26.786; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0618125723 A -> G LOC_Os06g31190-LOC_Os06g31200 intergenic_region ; MODIFIER silent_mutation Average:26.786; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0618125723 A -> DEL N N silent_mutation Average:26.786; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618125723 6.11E-06 NA mr1729_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251