Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0618125723:

Variant ID: vg0618125723 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18125723
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTGAACTATAAAAGGAGGACCTGTCACACCCTAAAAATCCCAAATATATAAATTGTTGTCTAAATTGGAATTATTAGAATTTATTTTAAAAGCCTAAA[A/G]
GAGAAGATCTAGTTTTAATTAATAAATTCCAATATAAAATGGGGCCAGATAAAATTTCATTAAATACTTTGCTTAATTCTATAATTCCTAGATTTTTCTG

Reverse complement sequence

CAGAAAAATCTAGGAATTATAGAATTAAGCAAAGTATTTAATGAAATTTTATCTGGCCCCATTTTATATTGGAATTTATTAATTAAAACTAGATCTTCTC[T/C]
TTTAGGCTTTTAAAATAAATTCTAATAATTCCAATTTAGACAACAATTTATATATTTGGGATTTTTAGGGTGTGACAGGTCCTCCTTTTATAGTTCAAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.20%	2.00%	29.14%	32.61%	NA
All Indica	2759	5.40%	3.10%	40.05%	51.50%	NA
All Japonica	1512	93.90%	0.40%	3.90%	1.79%	NA
Aus	269	1.90%	1.10%	72.49%	24.54%	NA
Indica I	595	3.50%	2.40%	31.09%	63.03%	NA
Indica II	465	5.40%	1.30%	20.43%	72.90%	NA
Indica III	913	5.10%	4.80%	58.71%	31.33%	NA
Indica Intermediate	786	7.00%	2.70%	36.77%	53.56%	NA
Temperate Japonica	767	96.60%	0.00%	0.52%	2.87%	NA
Tropical Japonica	504	87.70%	1.00%	10.91%	0.40%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	53.30%	1.10%	16.67%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618125723	A -> G	LOC_Os06g31190.1	upstream_gene_variant ; 4500.0bp to feature; MODIFIER	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0618125723	A -> G	LOC_Os06g31190-LOC_Os06g31200	intergenic_region ; MODIFIER	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0618125723	A -> DEL	N	N	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618125723	6.11E-06	NA	mr1729_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251