\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618125425:

Variant ID: vg0618125425 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18125425
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTCCCATCAAATAATCATGGTGAGAGGTTCTCATCCTCTTATCCCAGCCGAAGTCGGTCCTCCCGCTCTGGTCAAAGCTAGGCTCCCGTTTCCCGGT[G/A]
TAATAGGAGCCCAGAAGTCTTCACTTATTAAATGGTGAATGACATGGGCGCCCCCCGTATCAGGCAGCATGATGTGGTAGGCAACACGACCGAGGCGACG

Reverse complement sequence

CGTCGCCTCGGTCGTGTTGCCTACCACATCATGCTGCCTGATACGGGGGGCGCCCATGTCATTCACCATTTAATAAGTGAAGACTTCTGGGCTCCTATTA[C/T]
ACCGGGAAACGGGAGCCTAGCTTTGACCAGAGCGGGAGGACCGACTTCGGCTGGGATAAGAGGATGAGAACCTCTCACCATGATTATTTGATGGGACATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 36.30% 2.16% 0.25% NA
All Indica  2759 90.70% 5.50% 3.30% 0.43% NA
All Japonica  1512 6.00% 93.90% 0.13% 0.00% NA
Aus  269 97.40% 1.10% 1.49% 0.00% NA
Indica I  595 91.90% 3.90% 4.20% 0.00% NA
Indica II  465 88.40% 5.40% 4.73% 1.51% NA
Indica III  913 95.00% 4.20% 0.66% 0.22% NA
Indica Intermediate  786 86.30% 8.50% 4.83% 0.38% NA
Temperate Japonica  767 3.00% 96.70% 0.26% 0.00% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 41.10% 53.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618125425 G -> A LOC_Os06g31190.1 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:54.354; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0618125425 G -> A LOC_Os06g31190-LOC_Os06g31200 intergenic_region ; MODIFIER silent_mutation Average:54.354; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0618125425 G -> DEL N N silent_mutation Average:54.354; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618125425 9.18E-08 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 5.13E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 2.57E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.46E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.57E-11 mr1302 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 3.99E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.03E-09 mr1315 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 4.70E-09 mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 6.74E-08 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 2.42E-09 mr1420 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.86E-10 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 4.22E-10 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 6.01E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.04E-09 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 2.61E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.49E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 3.37E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 2.09E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 5.89E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 4.56E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 9.45E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 9.45E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.33E-09 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 1.30E-06 5.96E-11 mr1824 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618125425 NA 1.51E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251