\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618067784:

Variant ID: vg0618067784 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18067784
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCACCTGACGAGCAACAAAAACGAAGGGAATAAATGGTTGTGGGTTTTGCCGGGCAGGGCTTCTTCATACCACGGTGGGCTTGAACTCCTTGGCGCA[C/A]
TAGACCTTCTTGAGCTCGGCCTGGAGGCGACCTTGCTCCTCCTCCTTGCGGATGACCTCGTCCCTATTACTGCTCCTCGACGCCGCCCTCTTCGCCTTCT

Reverse complement sequence

AGAAGGCGAAGAGGGCGGCGTCGAGGAGCAGTAATAGGGACGAGGTCATCCGCAAGGAGGAGGAGCAAGGTCGCCTCCAGGCCGAGCTCAAGAAGGTCTA[G/T]
TGCGCCAAGGAGTTCAAGCCCACCGTGGTATGAAGAAGCCCTGCCCGGCAAAACCCACAACCATTTATTCCCTTCGTTTTTGTTGCTCGTCAGGTGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 8.60% 4.78% 8.95% NA
All Indica  2759 78.10% 14.40% 7.03% 0.51% NA
All Japonica  1512 71.40% 0.30% 1.52% 26.85% NA
Aus  269 98.10% 0.40% 1.49% 0.00% NA
Indica I  595 81.80% 4.00% 12.61% 1.51% NA
Indica II  465 85.60% 9.00% 5.38% 0.00% NA
Indica III  913 72.70% 25.00% 2.30% 0.00% NA
Indica Intermediate  786 77.00% 13.10% 9.29% 0.64% NA
Temperate Japonica  767 61.90% 0.50% 1.17% 36.38% NA
Tropical Japonica  504 94.40% 0.00% 0.79% 4.76% NA
Japonica Intermediate  241 53.10% 0.00% 4.15% 42.74% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 87.80% 4.40% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618067784 C -> A LOC_Os06g31060.2 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0618067784 C -> A LOC_Os06g31060.2 5_prime_UTR_variant ; 1408.0bp to feature; MODIFIER silent_mutation Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0618067784 C -> A LOC_Os06g31050.1 upstream_gene_variant ; 3200.0bp to feature; MODIFIER silent_mutation Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0618067784 C -> A LOC_Os06g31060.1 upstream_gene_variant ; 1239.0bp to feature; MODIFIER silent_mutation Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0618067784 C -> A LOC_Os06g31070.1 downstream_gene_variant ; 4438.0bp to feature; MODIFIER silent_mutation Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0618067784 C -> DEL N N silent_mutation Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618067784 NA 2.58E-09 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 2.79E-08 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 5.48E-07 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 7.56E-09 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 1.64E-07 NA mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 2.03E-08 2.02E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 3.75E-06 NA mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 4.07E-06 NA mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784 1.94E-08 1.53E-11 mr1695_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251