\
| Variant ID: vg0618067784 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18067784 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 112. )
CAATCACCTGACGAGCAACAAAAACGAAGGGAATAAATGGTTGTGGGTTTTGCCGGGCAGGGCTTCTTCATACCACGGTGGGCTTGAACTCCTTGGCGCA[C/A]
TAGACCTTCTTGAGCTCGGCCTGGAGGCGACCTTGCTCCTCCTCCTTGCGGATGACCTCGTCCCTATTACTGCTCCTCGACGCCGCCCTCTTCGCCTTCT
AGAAGGCGAAGAGGGCGGCGTCGAGGAGCAGTAATAGGGACGAGGTCATCCGCAAGGAGGAGGAGCAAGGTCGCCTCCAGGCCGAGCTCAAGAAGGTCTA[G/T]
TGCGCCAAGGAGTTCAAGCCCACCGTGGTATGAAGAAGCCCTGCCCGGCAAAACCCACAACCATTTATTCCCTTCGTTTTTGTTGCTCGTCAGGTGATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 8.60% | 4.78% | 8.95% | NA |
| All Indica | 2759 | 78.10% | 14.40% | 7.03% | 0.51% | NA |
| All Japonica | 1512 | 71.40% | 0.30% | 1.52% | 26.85% | NA |
| Aus | 269 | 98.10% | 0.40% | 1.49% | 0.00% | NA |
| Indica I | 595 | 81.80% | 4.00% | 12.61% | 1.51% | NA |
| Indica II | 465 | 85.60% | 9.00% | 5.38% | 0.00% | NA |
| Indica III | 913 | 72.70% | 25.00% | 2.30% | 0.00% | NA |
| Indica Intermediate | 786 | 77.00% | 13.10% | 9.29% | 0.64% | NA |
| Temperate Japonica | 767 | 61.90% | 0.50% | 1.17% | 36.38% | NA |
| Tropical Japonica | 504 | 94.40% | 0.00% | 0.79% | 4.76% | NA |
| Japonica Intermediate | 241 | 53.10% | 0.00% | 4.15% | 42.74% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 4.40% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618067784 | C -> A | LOC_Os06g31060.2 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0618067784 | C -> A | LOC_Os06g31060.2 | 5_prime_UTR_variant ; 1408.0bp to feature; MODIFIER | silent_mutation | Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0618067784 | C -> A | LOC_Os06g31050.1 | upstream_gene_variant ; 3200.0bp to feature; MODIFIER | silent_mutation | Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0618067784 | C -> A | LOC_Os06g31060.1 | upstream_gene_variant ; 1239.0bp to feature; MODIFIER | silent_mutation | Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0618067784 | C -> A | LOC_Os06g31070.1 | downstream_gene_variant ; 4438.0bp to feature; MODIFIER | silent_mutation | Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0618067784 | C -> DEL | N | N | silent_mutation | Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618067784 | NA | 2.58E-09 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 2.79E-08 | NA | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 5.48E-07 | NA | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 7.56E-09 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 1.64E-07 | NA | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 2.03E-08 | 2.02E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 3.75E-06 | NA | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 4.07E-06 | NA | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618067784 | 1.94E-08 | 1.53E-11 | mr1695_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |