\
| Variant ID: vg0617876285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17876285 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 236. )
TAAATCATCAGTATCTACAACTTTTGTTTTGGTCATTTTGGTATATTACTCTGTTTCAATAATTTGAATTTGAATTTCAAATTATGACAACCTGCAAACA[A/G]
CATTTTCAACCGAACTTTTATTTTAGTCATTTCTTCAACCGATAAAGTGATAGTAACATTGTTCACAAAATTTACATTTCTCTTATATGGTTTTGAAGTA
TACTTCAAAACCATATAAGAGAAATGTAAATTTTGTGAACAATGTTACTATCACTTTATCGGTTGAAGAAATGACTAAAATAAAAGTTCGGTTGAAAATG[T/C]
TGTTTGCAGGTTGTCATAATTTGAAATTCAAATTCAAATTATTGAAACAGAGTAATATACCAAAATGACCAAAACAAAAGTTGTAGATACTGATGATTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.70% | 7.40% | 1.90% | 0.00% | NA |
| All Indica | 2759 | 84.50% | 12.40% | 3.19% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.90% | 3.00% | 7.06% | 0.00% | NA |
| Indica II | 465 | 92.70% | 3.00% | 4.30% | 0.00% | NA |
| Indica III | 913 | 75.00% | 24.30% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 11.10% | 2.54% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617876285 | A -> G | LOC_Os06g30820.1 | upstream_gene_variant ; 2019.0bp to feature; MODIFIER | silent_mutation | Average:49.744; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0617876285 | A -> G | LOC_Os06g30820.4 | upstream_gene_variant ; 2019.0bp to feature; MODIFIER | silent_mutation | Average:49.744; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0617876285 | A -> G | LOC_Os06g30820.3 | upstream_gene_variant ; 2028.0bp to feature; MODIFIER | silent_mutation | Average:49.744; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0617876285 | A -> G | LOC_Os06g30820.2 | upstream_gene_variant ; 2028.0bp to feature; MODIFIER | silent_mutation | Average:49.744; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0617876285 | A -> G | LOC_Os06g30820-LOC_Os06g30830 | intergenic_region ; MODIFIER | silent_mutation | Average:49.744; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617876285 | 1.52E-07 | NA | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 4.70E-06 | NA | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.86E-08 | 1.81E-08 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 4.44E-08 | 6.98E-08 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 6.18E-10 | 1.84E-10 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 5.12E-09 | 9.11E-09 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 3.14E-06 | NA | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.15E-06 | 2.54E-07 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 2.37E-06 | 2.43E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 8.73E-07 | NA | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 2.23E-07 | 6.68E-07 | mr1110_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.27E-09 | 1.02E-08 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 5.02E-07 | NA | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.92E-08 | 4.33E-08 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.64E-09 | 2.25E-09 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.68E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 1.38E-06 | 1.15E-06 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 3.25E-08 | NA | mr1234_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617876285 | 3.08E-07 | 6.10E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |