Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617844295:

Variant ID: vg0617844295 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17844295
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.25, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAATGTGAACGTATGAATGCTTTTCACGATACAATTGCGCTCGAGTTGTTGCATCGACCATGAGACATGGGAATGTTGCGGCACAAGTGTTGTATGCT[G/A]
TAATTCTCTTTAGACTTGTATTTCCATGTGGTGCATGTCACCACATGGAATTGTTGTTGTAACTTGGGAGGAATAATTTGTGCTGCTGCAATATGTGAGG

Reverse complement sequence

CCTCACATATTGCAGCAGCACAAATTATTCCTCCCAAGTTACAACAACAATTCCATGTGGTGACATGCACCACATGGAAATACAAGTCTAAAGAGAATTA[C/T]
AGCATACAACACTTGTGCCGCAACATTCCCATGTCTCATGGTCGATGCAACAACTCGAGCGCAATTGTATCGTGAAAAGCATTCATACGTTCACATTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.80%	0.04%	0.02%	NA
All Indica	2759	97.50%	2.40%	0.07%	0.04%	NA
All Japonica	1512	9.90%	90.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	99.10%	0.70%	0.22%	0.00%	NA
Indica Intermediate	786	96.10%	3.80%	0.00%	0.13%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	20.40%	79.60%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617844295	G -> A	LOC_Os06g30770.1	upstream_gene_variant ; 1283.0bp to feature; MODIFIER	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N
vg0617844295	G -> A	LOC_Os06g30750.1	downstream_gene_variant ; 3376.0bp to feature; MODIFIER	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N
vg0617844295	G -> A	LOC_Os06g30760.1	downstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N
vg0617844295	G -> A	LOC_Os06g30780.1	downstream_gene_variant ; 3008.0bp to feature; MODIFIER	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N
vg0617844295	G -> A	LOC_Os06g30750.2	downstream_gene_variant ; 3376.0bp to feature; MODIFIER	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N
vg0617844295	G -> A	LOC_Os06g30760-LOC_Os06g30770	intergenic_region ; MODIFIER	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N
vg0617844295	G -> DEL	N	N	silent_mutation	Average:44.132; most accessible tissue: Callus, score: 73.617	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617844295	NA	9.51E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	1.59E-19	2.41E-89	mr1033	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	2.74E-11	3.17E-16	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	1.86E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.67E-33	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	6.53E-44	mr1092	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	5.50E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	5.24E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	1.65E-43	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.10E-52	mr1154	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	4.55E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	1.12E-10	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	3.15E-10	4.13E-46	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	8.60E-08	1.32E-10	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	1.49E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.36E-29	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	8.13E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	3.08E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	7.01E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	7.24E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	4.32E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	1.97E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	4.32E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	5.93E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.84E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	3.35E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	9.20E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	3.21E-08	1.46E-75	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	3.52E-08	3.52E-08	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	3.03E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	6.31E-26	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.70E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	4.46E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	1.91E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.98E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	4.84E-25	1.01E-125	mr1033_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	1.67E-13	1.35E-21	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	2.12E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	7.88E-11	5.44E-104	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	4.78E-09	1.09E-10	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617844295	NA	9.88E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251