\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617843171:

Variant ID: vg0617843171 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17843171
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCGTTGGGACGAAGAGGACGCACAGCATGAGGAGCACACCAAGCACGCGCAGTACAGCTACTAGTCCGAGCAAAAAGTTGAAGAGCCCAGTGGTGCG[C/T]
GCCATGGTGTCCGAATTGAAGGTCCACAACGAGTTGCAGAAGGACAAAGTAGCAGCCATGGACAACTACTTGGGCAGGCGTGAGAAGAAGAAGGATGATG

Reverse complement sequence

CATCATCCTTCTTCTTCTCACGCCTGCCCAAGTAGTTGTCCATGGCTGCTACTTTGTCCTTCTGCAACTCGTTGTGGACCTTCAATTCGGACACCATGGC[G/A]
CGCACCACTGGGCTCTTCAACTTTTTGCTCGGACTAGTAGCTGTACTGCGCGTGCTTGGTGTGCTCCTCATGCTGTGCGTCCTCTTCGTCCCAACGCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 10.00% 0.11% 0.00% NA
All Indica  2759 84.00% 15.80% 0.18% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 87.70% 12.10% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 79.70% 20.30% 0.00% 0.00% NA
Indica Intermediate  786 78.00% 21.60% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617843171 C -> T LOC_Os06g30770.1 upstream_gene_variant ; 2407.0bp to feature; MODIFIER silent_mutation Average:75.601; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N
vg0617843171 C -> T LOC_Os06g30750.1 downstream_gene_variant ; 2252.0bp to feature; MODIFIER silent_mutation Average:75.601; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N
vg0617843171 C -> T LOC_Os06g30780.1 downstream_gene_variant ; 4132.0bp to feature; MODIFIER silent_mutation Average:75.601; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N
vg0617843171 C -> T LOC_Os06g30750.2 downstream_gene_variant ; 2252.0bp to feature; MODIFIER silent_mutation Average:75.601; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N
vg0617843171 C -> T LOC_Os06g30760.1 intron_variant ; MODIFIER silent_mutation Average:75.601; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617843171 C T -0.01 -0.01 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617843171 NA 2.32E-17 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0617843171 NA 6.79E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 2.12E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.67E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.71E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.48E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 8.79E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 1.96E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 8.81E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.25E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 1.86E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 2.56E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 2.97E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 5.91E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 4.41E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.23E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 1.75E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 3.67E-06 NA mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 7.62E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.22E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617843171 NA 3.29E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251