\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617826668:

Variant ID: vg0617826668 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17826668
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, C: 0.14, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGGATTGAATTCAACCTTTTTTTCTTTAAAATTCCTATGAATGAACAACACTATAGAGTTTTCGGAGGAAAGTTAATAAAAGCTTTAACGTTTTGAA[A/C]
ATTTTTCTTCAAGTTTATCTGCCTCATTCAATTCCTGAGACAATTCATGTGTTTTTCCTATGGTCTATTCAAACAACCTTTTTTATTTGTTTGTAATCAT

Reverse complement sequence

ATGATTACAAACAAATAAAAAAGGTTGTTTGAATAGACCATAGGAAAAACACATGAATTGTCTCAGGAATTGAATGAGGCAGATAAACTTGAAGAAAAAT[T/G]
TTCAAAACGTTAAAGCTTTTATTAACTTTCCTCCGAAAACTCTATAGTGTTGTTCATTCATAGGAATTTTAAAGAAAAAAAGGTTGAATTCAATCCTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 29.30% 1.76% 0.00% NA
All Indica  2759 65.30% 31.80% 2.94% 0.00% NA
All Japonica  1512 71.90% 28.00% 0.07% 0.00% NA
Aus  269 77.00% 22.70% 0.37% 0.00% NA
Indica I  595 66.40% 27.20% 6.39% 0.00% NA
Indica II  465 83.40% 13.10% 3.44% 0.00% NA
Indica III  913 55.10% 44.40% 0.55% 0.00% NA
Indica Intermediate  786 65.50% 31.70% 2.80% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 29.20% 70.60% 0.20% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617826668 A -> C LOC_Os06g30730.1 upstream_gene_variant ; 1853.0bp to feature; MODIFIER silent_mutation Average:52.662; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0617826668 A -> C LOC_Os06g30730-LOC_Os06g30740 intergenic_region ; MODIFIER silent_mutation Average:52.662; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617826668 3.38E-08 NA mr1068 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 7.72E-07 5.69E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 7.29E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 1.15E-09 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 3.69E-06 NA mr1094 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 9.52E-06 9.91E-10 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 2.71E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 5.18E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 3.09E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 1.72E-06 6.84E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 5.32E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 6.77E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 7.05E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 5.78E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 5.58E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 2.11E-10 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 1.04E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 2.96E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 3.47E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 1.38E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 2.11E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 1.56E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 2.19E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 7.56E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 7.60E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 8.58E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 5.92E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617826668 NA 5.28E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251