\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617821096:

Variant ID: vg0617821096 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17821096
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTTGTTAAGATGACAATATTGCTAAAATTCTGGTAAGATTTCTTATGTATTGACTAAATTTGATAACAAACTAAATGTAGATATTTTCTAAAAAACT[C/T,G]
TAAAAAAATTGATATGGTTAAAAATGGCATCAAGTGAATAAGCCGGAATATTTATGGGTGTATAGCTATACACTTGTGCATGCAGTTGTGTGTGCATGAT

Reverse complement sequence

ATCATGCACACACAACTGCATGCACAAGTGTATAGCTATACACCCATAAATATTCCGGCTTATTCACTTGATGCCATTTTTAACCATATCAATTTTTTTA[G/A,C]
AGTTTTTTAGAAAATATCTACATTTAGTTTGTTATCAAATTTAGTCAATACATAAGAAATCTTACCAGAATTTTAGCAATATTGTCATCTTAACAAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.90% 0.06% 0.00% G: 0.02%
All Indica  2759 97.50% 2.40% 0.07% 0.00% G: 0.04%
All Japonica  1512 6.50% 93.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.00% 0.70% 0.22% 0.00% G: 0.11%
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617821096 C -> G LOC_Os06g30710.1 downstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> G LOC_Os06g30720.1 downstream_gene_variant ; 3417.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> G LOC_Os06g30730.1 downstream_gene_variant ; 1188.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> G LOC_Os06g30710.3 downstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> G LOC_Os06g30720-LOC_Os06g30730 intergenic_region ; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> T LOC_Os06g30710.1 downstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> T LOC_Os06g30720.1 downstream_gene_variant ; 3417.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> T LOC_Os06g30730.1 downstream_gene_variant ; 1188.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> T LOC_Os06g30710.3 downstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0617821096 C -> T LOC_Os06g30720-LOC_Os06g30730 intergenic_region ; MODIFIER silent_mutation Average:78.954; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617821096 C G -0.01 -0.02 -0.01 -0.02 -0.03 -0.02
vg0617821096 C T 0.01 0.0 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617821096 2.22E-07 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 7.58E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 5.10E-07 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 2.22E-10 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 5.58E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 3.26E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 4.71E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 2.28E-08 NA mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 4.20E-08 NA mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 1.42E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 5.18E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 2.71E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 5.17E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 1.00E-06 2.74E-70 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 2.09E-15 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 7.35E-11 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 1.11E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 4.22E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 2.20E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 8.00E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 3.44E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 5.74E-12 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 2.31E-07 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 4.00E-07 NA mr1410_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 1.48E-06 NA mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617821096 NA 2.56E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251