\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617651311:

Variant ID: vg0617651311 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17651311
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, C: 0.11, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATAATATATTTTCTTTTAACCCAAATCATGCCATGTGCATTTTGCTATTCCCTCCATTGAAAACTACTTGTTGTTCTACTTTTATCCTAAACCAAAC[A/C]
TTTACAGTTTAATCGTTAAATTTCTATATATTCATATAGGTTAACATTATAGGTTTTATGTTTTTATGACCATGAGAAATATTTTCATAATATATGTTGT

Reverse complement sequence

ACAACATATATTATGAAAATATTTCTCATGGTCATAAAAACATAAAACCTATAATGTTAACCTATATGAATATATAGAAATTTAACGATTAAACTGTAAA[T/G]
GTTTGGTTTAGGATAAAAGTAGAACAACAAGTAGTTTTCAATGGAGGGAATAGCAAAATGCACATGGCATGATTTGGGTTAAAAGAAAATATATTATAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 22.80% 10.66% 23.17% NA
All Indica  2759 15.80% 33.50% 14.68% 35.99% NA
All Japonica  1512 96.80% 1.00% 1.12% 1.06% NA
Aus  269 16.70% 35.70% 24.54% 23.05% NA
Indica I  595 19.70% 22.70% 17.98% 39.66% NA
Indica II  465 10.80% 27.70% 17.20% 44.30% NA
Indica III  913 14.60% 42.30% 12.05% 31.11% NA
Indica Intermediate  786 17.30% 35.00% 13.74% 33.97% NA
Temperate Japonica  767 95.60% 1.40% 1.56% 1.43% NA
Tropical Japonica  504 98.80% 0.40% 0.40% 0.40% NA
Japonica Intermediate  241 96.70% 0.80% 1.24% 1.24% NA
VI/Aromatic  96 62.50% 22.90% 7.29% 7.29% NA
Intermediate  90 48.90% 22.20% 10.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617651311 A -> C LOC_Os06g30510.1 downstream_gene_variant ; 4678.0bp to feature; MODIFIER silent_mutation Average:44.241; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0617651311 A -> C LOC_Os06g30520.1 downstream_gene_variant ; 2678.0bp to feature; MODIFIER silent_mutation Average:44.241; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0617651311 A -> C LOC_Os06g30510-LOC_Os06g30520 intergenic_region ; MODIFIER silent_mutation Average:44.241; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0617651311 A -> DEL N N silent_mutation Average:44.241; most accessible tissue: Minghui63 root, score: 67.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617651311 NA 8.78E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.03E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 3.24E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 4.12E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 3.55E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 2.57E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.70E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 3.24E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 8.28E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.98E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 4.81E-06 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.20E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 9.26E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.12E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 3.65E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.32E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 1.14E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 6.44E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 2.57E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 5.70E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 1.44E-08 8.51E-09 mr1211_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617651311 NA 3.76E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251