\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617639143:

Variant ID: vg0617639143 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17639143
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


AATCAATCGAATCGTTTTTTCATATTGCTTTTAGTTTTCTCTTAGTTTGTCTATCTTTGCCGGTTTGCGCTGTAAACCGTCCACCGCCGCTGCGAGAGTG[C/T]
GACATCTTTTTGTAGGTTTGTCCTGAAAATCTTCTGTTTTCAGGATTAAGGTGCTGCGATCGTGCTTGTCAACTTGTCAAAAAAGTTGCCAACACGATTT

Reverse complement sequence

AAATCGTGTTGGCAACTTTTTTGACAAGTTGACAAGCACGATCGCAGCACCTTAATCCTGAAAACAGAAGATTTTCAGGACAAACCTACAAAAAGATGTC[G/A]
CACTCTCGCAGCGGCGGTGGACGGTTTACAGCGCAAACCGGCAAAGATAGACAAACTAAGAGAAAACTAAAAGCAATATGAAAAAACGATTCGATTGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 9.30% 0.34% 58.99% NA
All Indica  2759 3.30% 8.80% 0.40% 87.46% NA
All Japonica  1512 87.00% 8.50% 0.00% 4.50% NA
Aus  269 13.00% 1.50% 1.12% 84.39% NA
Indica I  595 4.40% 6.20% 0.17% 89.24% NA
Indica II  465 4.10% 2.80% 0.00% 93.12% NA
Indica III  913 1.10% 13.80% 0.44% 84.67% NA
Indica Intermediate  786 4.60% 8.70% 0.76% 86.01% NA
Temperate Japonica  767 93.10% 0.10% 0.00% 6.78% NA
Tropical Japonica  504 76.40% 22.20% 0.00% 1.39% NA
Japonica Intermediate  241 89.60% 6.60% 0.00% 3.73% NA
VI/Aromatic  96 3.10% 57.30% 1.04% 38.54% NA
Intermediate  90 41.10% 10.00% 1.11% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617639143 C -> T LOC_Os06g30510.1 upstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:8.245; most accessible tissue: Callus, score: 23.988 N N N N
vg0617639143 C -> T LOC_Os06g30500-LOC_Os06g30510 intergenic_region ; MODIFIER silent_mutation Average:8.245; most accessible tissue: Callus, score: 23.988 N N N N
vg0617639143 C -> DEL N N silent_mutation Average:8.245; most accessible tissue: Callus, score: 23.988 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617639143 NA 9.92E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 2.30E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.70E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 5.77E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 5.44E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.92E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 5.73E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 5.03E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 8.61E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 3.43E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.07E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 1.27E-07 NA mr1068_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.18E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 7.09E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 2.23E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.06E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.46E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 2.84E-06 NA mr1096_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.66E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 9.13E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 6.25E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 3.10E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.11E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 1.12E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 8.06E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 NA 8.42E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143 8.03E-06 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251