Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617639143:

Variant ID: vg0617639143 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17639143
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

AATCAATCGAATCGTTTTTTCATATTGCTTTTAGTTTTCTCTTAGTTTGTCTATCTTTGCCGGTTTGCGCTGTAAACCGTCCACCGCCGCTGCGAGAGTG[C/T]
GACATCTTTTTGTAGGTTTGTCCTGAAAATCTTCTGTTTTCAGGATTAAGGTGCTGCGATCGTGCTTGTCAACTTGTCAAAAAAGTTGCCAACACGATTT

Reverse complement sequence

AAATCGTGTTGGCAACTTTTTTGACAAGTTGACAAGCACGATCGCAGCACCTTAATCCTGAAAACAGAAGATTTTCAGGACAAACCTACAAAAAGATGTC[G/A]
CACTCTCGCAGCGGCGGTGGACGGTTTACAGCGCAAACCGGCAAAGATAGACAAACTAAGAGAAAACTAAAAGCAATATGAAAAAACGATTCGATTGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.30%	9.30%	0.34%	58.99%	NA
All Indica	2759	3.30%	8.80%	0.40%	87.46%	NA
All Japonica	1512	87.00%	8.50%	0.00%	4.50%	NA
Aus	269	13.00%	1.50%	1.12%	84.39%	NA
Indica I	595	4.40%	6.20%	0.17%	89.24%	NA
Indica II	465	4.10%	2.80%	0.00%	93.12%	NA
Indica III	913	1.10%	13.80%	0.44%	84.67%	NA
Indica Intermediate	786	4.60%	8.70%	0.76%	86.01%	NA
Temperate Japonica	767	93.10%	0.10%	0.00%	6.78%	NA
Tropical Japonica	504	76.40%	22.20%	0.00%	1.39%	NA
Japonica Intermediate	241	89.60%	6.60%	0.00%	3.73%	NA
VI/Aromatic	96	3.10%	57.30%	1.04%	38.54%	NA
Intermediate	90	41.10%	10.00%	1.11%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617639143	C -> T	LOC_Os06g30510.1	upstream_gene_variant ; 248.0bp to feature; MODIFIER	silent_mutation	Average:8.245; most accessible tissue: Callus, score: 23.988	N	N	N	N
vg0617639143	C -> T	LOC_Os06g30500-LOC_Os06g30510	intergenic_region ; MODIFIER	silent_mutation	Average:8.245; most accessible tissue: Callus, score: 23.988	N	N	N	N
vg0617639143	C -> DEL	N	N	silent_mutation	Average:8.245; most accessible tissue: Callus, score: 23.988	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617639143	NA	9.92E-10	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	2.30E-09	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.70E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	5.77E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	5.44E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.92E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	5.73E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	5.03E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	8.61E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	3.43E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.07E-07	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	1.27E-07	NA	mr1068_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.18E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	7.09E-09	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	2.23E-09	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.06E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.46E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	2.84E-06	NA	mr1096_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.66E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	9.13E-06	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	6.25E-08	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	3.10E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.11E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	1.12E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	8.06E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	NA	8.42E-09	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617639143	8.03E-06	NA	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251