Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0617539354:

Variant ID: vg0617539354 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17539354
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTTTGGCTTTAAGAGTTAAAATAAATATATGAGGAAGACATTTGCATTGTGAATATGTAACTTGGGAGTTTGAATTGTATGTTTTTGTACATATTTT[G/T]
GGTTGTTGGTCGGGAGTTATTGCCTATTGGGGAGAACGGCTGGGAATATATGTGATTGTGATATGATTTGTTTTTTTGAGAGCATTGCTAGCAATCCTGA

Reverse complement sequence

TCAGGATTGCTAGCAATGCTCTCAAAAAAACAAATCATATCACAATCACATATATTCCCAGCCGTTCTCCCCAATAGGCAATAACTCCCGACCAACAACC[C/A]
AAAATATGTACAAAAACATACAATTCAAACTCCCAAGTTACATATTCACAATGCAAATGTCTTCCTCATATATTTATTTTAACTCTTAAAGCCAAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	30.60%	0.06%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.04%	0.00%	NA
All Japonica	1512	11.90%	88.00%	0.07%	0.00%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.90%	3.90%	0.13%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	24.80%	75.00%	0.20%	0.00%	NA
Japonica Intermediate	241	11.20%	88.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617539354	G -> T	LOC_Os06g30350.1	downstream_gene_variant ; 4871.0bp to feature; MODIFIER	silent_mutation	Average:47.697; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0617539354	G -> T	LOC_Os06g30370.1	downstream_gene_variant ; 568.0bp to feature; MODIFIER	silent_mutation	Average:47.697; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0617539354	G -> T	LOC_Os06g30350-LOC_Os06g30370	intergenic_region ; MODIFIER	silent_mutation	Average:47.697; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617539354	NA	5.12E-11	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	1.14E-07	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	6.30E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	1.30E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	2.43E-10	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	2.43E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	7.22E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	2.34E-06	mr1469_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	3.65E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	7.50E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	4.13E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	1.86E-07	mr1550_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	5.87E-07	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	4.19E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	1.82E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	NA	2.57E-12	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617539354	7.46E-06	7.46E-06	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251