\
| Variant ID: vg0617527186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17527186 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 35. )
ATGAACCGGCCTTATCCATTAAATATGGGTTGGTCTTGCCCTATATAGGCCCTTCTCCACGTCTAACTCGGGATAGAAACCAAAGGAAACACGAAACCTG[C/T]
CTTCCTGAGCAAGGAAACCTGAGACCCGACGAAAACAGACTCGGACTCGGACCCTGACGGTCTGACTGTCCACATACCTGCGGTCAGACCGGCCCTACAA
TTGTAGGGCCGGTCTGACCGCAGGTATGTGGACAGTCAGACCGTCAGGGTCCGAGTCCGAGTCTGTTTTCGTCGGGTCTCAGGTTTCCTTGCTCAGGAAG[G/A]
CAGGTTTCGTGTTTCCTTTGGTTTCTATCCCGAGTTAGACGTGGAGAAGGGCCTATATAGGGCAAGACCAACCCATATTTAATGGATAAGGCCGGTTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 4.80% | 1.18% | 1.90% | NA |
| All Indica | 2759 | 90.20% | 7.60% | 1.81% | 0.36% | NA |
| All Japonica | 1512 | 97.80% | 0.70% | 0.07% | 1.52% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.74% | 0.74% | NA |
| Indica I | 595 | 97.00% | 0.00% | 2.86% | 0.17% | NA |
| Indica II | 465 | 91.20% | 7.30% | 1.51% | 0.00% | NA |
| Indica III | 913 | 85.30% | 13.60% | 0.99% | 0.11% | NA |
| Indica Intermediate | 786 | 90.20% | 6.60% | 2.16% | 1.02% | NA |
| Temperate Japonica | 767 | 95.80% | 1.20% | 0.13% | 2.87% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 41.70% | 1.00% | 3.12% | 54.17% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617527186 | C -> T | LOC_Os06g30340.1 | upstream_gene_variant ; 3041.0bp to feature; MODIFIER | silent_mutation | Average:42.077; most accessible tissue: Zhenshan97 flower, score: 65.164 | N | N | N | N |
| vg0617527186 | C -> T | LOC_Os06g30340-LOC_Os06g30350 | intergenic_region ; MODIFIER | silent_mutation | Average:42.077; most accessible tissue: Zhenshan97 flower, score: 65.164 | N | N | N | N |
| vg0617527186 | C -> DEL | N | N | silent_mutation | Average:42.077; most accessible tissue: Zhenshan97 flower, score: 65.164 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617527186 | 4.51E-06 | 1.02E-10 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | NA | 9.38E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 8.27E-06 | 9.23E-09 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | NA | 5.46E-08 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 9.42E-06 | NA | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 2.63E-06 | 5.03E-11 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 2.60E-06 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 5.81E-08 | 2.04E-10 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 2.16E-07 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 5.96E-07 | 4.51E-09 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 7.57E-08 | NA | mr1144_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | 4.52E-08 | 2.96E-12 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617527186 | NA | 3.65E-08 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |