\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617514501:

Variant ID: vg0617514501 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17514501
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAGGGCACGACAACAATCGAGCGGGGAGGCCGGTCGGCGGGAGAAGCGCAGGGGGCGACAGCCATTGGGCGGAGAGGCGGTTGAGGAGTGGCGTGTGG[T/C]
AGCTGATAACAGAGGAGCTGTGCGCCGCGACAGACGGGAGACGGGAGAGGAGGGAGCGGCGGCCGGAGCTCCGGGCCATCGTCGGACTGTGGGTCGTCGA

Reverse complement sequence

TCGACGACCCACAGTCCGACGATGGCCCGGAGCTCCGGCCGCCGCTCCCTCCTCTCCCGTCTCCCGTCTGTCGCGGCGCACAGCTCCTCTGTTATCAGCT[A/G]
CCACACGCCACTCCTCAACCGCCTCTCCGCCCAATGGCTGTCGCCCCCTGCGCTTCTCCCGCCGACCGGCCTCCCCGCTCGATTGTTGTCGTGCCCTGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 29.70% 0.08% 2.09% NA
All Indica  2759 97.90% 1.70% 0.00% 0.43% NA
All Japonica  1512 12.30% 85.70% 0.13% 1.85% NA
Aus  269 88.10% 10.80% 0.00% 1.12% NA
Indica I  595 97.50% 2.20% 0.00% 0.34% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.00% 0.11% NA
Indica Intermediate  786 95.40% 3.40% 0.00% 1.15% NA
Temperate Japonica  767 3.70% 92.60% 0.26% 3.52% NA
Tropical Japonica  504 26.00% 74.00% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.00% 0.41% NA
VI/Aromatic  96 41.70% 3.10% 0.00% 55.21% NA
Intermediate  90 63.30% 31.10% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617514501 T -> C LOC_Os06g30330.1 upstream_gene_variant ; 4550.0bp to feature; MODIFIER silent_mutation Average:90.121; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0617514501 T -> C LOC_Os06g30320.1 downstream_gene_variant ; 2540.0bp to feature; MODIFIER silent_mutation Average:90.121; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0617514501 T -> C LOC_Os06g30320-LOC_Os06g30330 intergenic_region ; MODIFIER silent_mutation Average:90.121; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N
vg0617514501 T -> DEL N N silent_mutation Average:90.121; most accessible tissue: Zhenshan97 young leaf, score: 95.157 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617514501 T C 0.0 0.0 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617514501 NA 7.54E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 NA 2.68E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 NA 7.81E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 3.30E-06 1.88E-20 mr1165_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 8.97E-08 4.46E-10 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 NA 2.85E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 NA 6.11E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 NA 1.14E-22 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617514501 3.07E-07 3.07E-07 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251