\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617336375:

Variant ID: vg0617336375 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17336375
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCCGATCGTATCTGATTTAACTTCATTTGTTCTATATGCTCCATTGACATGTTAAATCTGCCATTTATATTAAGATGTTGCTATATCTAAATATGTTA[G/A]
GCTTTTGCTCAATATACTGTACTTGCTATAATATCCTGATATAGAGTAGAATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATTGGCTATGCTAT

Reverse complement sequence

ATAGCATAGCCAATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATTCTACTCTATATCAGGATATTATAGCAAGTACAGTATATTGAGCAAAAGC[C/T]
TAACATATTTAGATATAGCAACATCTTAATATAAATGGCAGATTTAACATGTCAATGGAGCATATAGAACAAATGAAGTTAAATCAGATACGATCGGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.40% 0.28% 0.00% NA
All Indica  2759 98.90% 1.10% 0.04% 0.00% NA
All Japonica  1512 91.80% 7.40% 0.79% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 0.00% 1.56% 0.00% NA
Tropical Japonica  504 78.40% 21.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617336375 G -> A LOC_Os06g30080.1 upstream_gene_variant ; 1272.0bp to feature; MODIFIER silent_mutation Average:27.543; most accessible tissue: Zhenshan97 flag leaf, score: 41.874 N N N N
vg0617336375 G -> A LOC_Os06g30070.1 downstream_gene_variant ; 4728.0bp to feature; MODIFIER silent_mutation Average:27.543; most accessible tissue: Zhenshan97 flag leaf, score: 41.874 N N N N
vg0617336375 G -> A LOC_Os06g30080-LOC_Os06g30090 intergenic_region ; MODIFIER silent_mutation Average:27.543; most accessible tissue: Zhenshan97 flag leaf, score: 41.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617336375 8.35E-07 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 1.64E-09 NA mr1226 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 4.14E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 NA 3.20E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 8.94E-07 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 4.65E-08 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 1.81E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 8.02E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 8.76E-09 NA mr1103_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 1.78E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 1.10E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 1.72E-10 NA mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375 1.06E-07 NA mr1437_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251