Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617336375:

Variant ID: vg0617336375 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17336375
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGCCGATCGTATCTGATTTAACTTCATTTGTTCTATATGCTCCATTGACATGTTAAATCTGCCATTTATATTAAGATGTTGCTATATCTAAATATGTTA[G/A]
GCTTTTGCTCAATATACTGTACTTGCTATAATATCCTGATATAGAGTAGAATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATTGGCTATGCTAT

Reverse complement sequence

ATAGCATAGCCAATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATTCTACTCTATATCAGGATATTATAGCAAGTACAGTATATTGAGCAAAAGC[C/T]
TAACATATTTAGATATAGCAACATCTTAATATAAATGGCAGATTTAACATGTCAATGGAGCATATAGAACAAATGAAGTTAAATCAGATACGATCGGCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.30%	5.40%	0.28%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.04%	0.00%	NA
All Japonica	1512	91.80%	7.40%	0.79%	0.00%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	0.00%	1.56%	0.00%	NA
Tropical Japonica	504	78.40%	21.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617336375	G -> A	LOC_Os06g30080.1	upstream_gene_variant ; 1272.0bp to feature; MODIFIER	silent_mutation	Average:27.543; most accessible tissue: Zhenshan97 flag leaf, score: 41.874	N	N	N	N
vg0617336375	G -> A	LOC_Os06g30070.1	downstream_gene_variant ; 4728.0bp to feature; MODIFIER	silent_mutation	Average:27.543; most accessible tissue: Zhenshan97 flag leaf, score: 41.874	N	N	N	N
vg0617336375	G -> A	LOC_Os06g30080-LOC_Os06g30090	intergenic_region ; MODIFIER	silent_mutation	Average:27.543; most accessible tissue: Zhenshan97 flag leaf, score: 41.874	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617336375	8.35E-07	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	1.64E-09	NA	mr1226	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	4.14E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	NA	3.20E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	8.94E-07	NA	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	4.65E-08	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	1.81E-08	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	8.02E-06	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	8.76E-09	NA	mr1103_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	1.78E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	1.10E-06	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	1.72E-10	NA	mr1226_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617336375	1.06E-07	NA	mr1437_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251