Search for Variation information by Variation ID:
Detailed information for vg0617087390:
| Variant ID: vg0617087390 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17087390 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CTCGGCTTCATCTTTGTCTTGGGGGAGTTCTTGAGAAGTCAAAAATCGTATGAGGGGCTCTCGCCAGTCTGCTTCAACCATAGCTACGTCATGAGTGTCC[G/A]
CAAATTGAGTAGTATCTTTGTGAGGTACTGTCGGCGTATAAAGGTGTTCGACGAAAACATCAGAGGGTGCCGCCTCGCGCTTGGATCCGAAGTTGGCAAG
Reverse complement sequence
CTTGCCAACTTCGGATCCAAGCGCGAGGCGGCACCCTCTGATGTTTTCGTCGAACACCTTTATACGCCGACAGTACCTCACAAAGATACTACTCAATTTG[C/T]
GGACACTCATGACGTAGCTATGGTTGAAGCAGACTGGCGAGAGCCCCTCATACGATTTTTGACTTCTCAAGAACTCCCCCAAGACAAAGATGAAGCCGAG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 7.40% | 30.74% | 5.80% | NA |
| All Indica | 2759 | 33.30% | 12.50% | 46.90% | 7.32% | NA |
| All Japonica | 1512 | 94.00% | 0.30% | 2.12% | 3.57% | NA |
| Aus | 269 | 79.90% | 0.00% | 18.96% | 1.12% | NA |
| Indica I | 595 | 45.20% | 2.20% | 38.49% | 14.12% | NA |
| Indica II | 465 | 55.90% | 5.20% | 34.62% | 4.30% | NA |
| Indica III | 913 | 11.30% | 23.20% | 59.91% | 5.59% | NA |
| Indica Intermediate | 786 | 36.50% | 12.10% | 45.42% | 5.98% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.91% | 1.17% | NA |
| Tropical Japonica | 504 | 89.30% | 0.00% | 4.17% | 6.55% | NA |
| Japonica Intermediate | 241 | 91.70% | 1.70% | 1.66% | 4.98% | NA |
| VI/Aromatic | 96 | 30.20% | 1.00% | 58.33% | 10.42% | NA |
| Intermediate | 90 | 68.90% | 3.30% | 22.22% | 5.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617087390 | G -> A | LOC_Os06g29760.1 | missense_variant ; p.Ala1582Val; MODERATE | nonsynonymous_codon ; A1582M | Average:29.167; most accessible tissue: Minghui63 flag leaf, score: 42.823 | probably damaging  |
2.855 |
TOLERATED | 0.53 |
| vg0617087390 | G -> A | LOC_Os06g29760.1 | missense_variant ; p.Ala1582Val; MODERATE | nonsynonymous_codon ; A1582V | Average:29.167; most accessible tissue: Minghui63 flag leaf, score: 42.823 | benign |
1.453 |
TOLERATED | 0.25 |
| vg0617087390 | G -> DEL | LOC_Os06g29760.1 | N | frameshift_variant | Average:29.167; most accessible tissue: Minghui63 flag leaf, score: 42.823 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617087390 | NA | 9.28E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617087390 | NA | 9.74E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617087390 | NA | 4.88E-07 | mr1400_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617087390 | NA | 2.48E-06 | mr1400_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617087390 | NA | 3.05E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617087390 | NA | 8.86E-07 | mr1899_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617087390 | NA | 1.64E-06 | mr1899_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |