\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617087390:

Variant ID: vg0617087390 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17087390
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGGCTTCATCTTTGTCTTGGGGGAGTTCTTGAGAAGTCAAAAATCGTATGAGGGGCTCTCGCCAGTCTGCTTCAACCATAGCTACGTCATGAGTGTCC[G/A]
CAAATTGAGTAGTATCTTTGTGAGGTACTGTCGGCGTATAAAGGTGTTCGACGAAAACATCAGAGGGTGCCGCCTCGCGCTTGGATCCGAAGTTGGCAAG

Reverse complement sequence

CTTGCCAACTTCGGATCCAAGCGCGAGGCGGCACCCTCTGATGTTTTCGTCGAACACCTTTATACGCCGACAGTACCTCACAAAGATACTACTCAATTTG[C/T]
GGACACTCATGACGTAGCTATGGTTGAAGCAGACTGGCGAGAGCCCCTCATACGATTTTTGACTTCTCAAGAACTCCCCCAAGACAAAGATGAAGCCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 7.40% 30.74% 5.80% NA
All Indica  2759 33.30% 12.50% 46.90% 7.32% NA
All Japonica  1512 94.00% 0.30% 2.12% 3.57% NA
Aus  269 79.90% 0.00% 18.96% 1.12% NA
Indica I  595 45.20% 2.20% 38.49% 14.12% NA
Indica II  465 55.90% 5.20% 34.62% 4.30% NA
Indica III  913 11.30% 23.20% 59.91% 5.59% NA
Indica Intermediate  786 36.50% 12.10% 45.42% 5.98% NA
Temperate Japonica  767 97.90% 0.00% 0.91% 1.17% NA
Tropical Japonica  504 89.30% 0.00% 4.17% 6.55% NA
Japonica Intermediate  241 91.70% 1.70% 1.66% 4.98% NA
VI/Aromatic  96 30.20% 1.00% 58.33% 10.42% NA
Intermediate  90 68.90% 3.30% 22.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617087390 G -> A LOC_Os06g29760.1 missense_variant ; p.Ala1582Val; MODERATE nonsynonymous_codon ; A1582M Average:29.167; most accessible tissue: Minghui63 flag leaf, score: 42.823 probably damaging 2.855 TOLERATED 0.53
vg0617087390 G -> A LOC_Os06g29760.1 missense_variant ; p.Ala1582Val; MODERATE nonsynonymous_codon ; A1582V Average:29.167; most accessible tissue: Minghui63 flag leaf, score: 42.823 benign 1.453 TOLERATED 0.25
vg0617087390 G -> DEL LOC_Os06g29760.1 N frameshift_variant Average:29.167; most accessible tissue: Minghui63 flag leaf, score: 42.823 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617087390 NA 9.28E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617087390 NA 9.74E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617087390 NA 4.88E-07 mr1400_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617087390 NA 2.48E-06 mr1400_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617087390 NA 3.05E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617087390 NA 8.86E-07 mr1899_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617087390 NA 1.64E-06 mr1899_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251