Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616962436:

Variant ID: vg0616962436 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16962436
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAATAGTGGTGTTTGCATTGGAAGAGTAGTATCTAGTAGTAGTTTTATGATGATGTGGAGTTTATGGAAACTATGTCAGTGTGTTGTGTTGGGAATGG[C/A]
CTAATATGCTTAAGATAACACTATATCAGTAACCCCTGTTTGCTATAGCTAGAAGGTCACCTGGTCACATGATATATATCCCTTCTTTTTTATAGTTGGT

Reverse complement sequence

ACCAACTATAAAAAAGAAGGGATATATATCATGTGACCAGGTGACCTTCTAGCTATAGCAAACAGGGGTTACTGATATAGTGTTATCTTAAGCATATTAG[G/T]
CCATTCCCAACACAACACACTGACATAGTTTCCATAAACTCCACATCATCATAAAACTACTACTAGATACTACTCTTCCAATGCAAACACCACTATTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	5.70%	0.55%	26.47%	NA
All Indica	2759	55.90%	0.50%	0.80%	42.81%	NA
All Japonica	1512	88.00%	10.60%	0.00%	1.46%	NA
Aus	269	84.40%	1.90%	0.74%	13.01%	NA
Indica I	595	88.10%	0.00%	0.50%	11.43%	NA
Indica II	465	81.10%	1.50%	0.86%	16.56%	NA
Indica III	913	15.30%	0.50%	1.20%	82.91%	NA
Indica Intermediate	786	63.60%	0.40%	0.51%	35.50%	NA
Temperate Japonica	767	97.90%	0.30%	0.00%	1.83%	NA
Tropical Japonica	504	70.80%	28.00%	0.00%	1.19%	NA
Japonica Intermediate	241	92.10%	7.10%	0.00%	0.83%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	71.10%	12.20%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616962436	C -> A	LOC_Os06g29580.1	upstream_gene_variant ; 3239.0bp to feature; MODIFIER	silent_mutation	Average:72.781; most accessible tissue: Callus, score: 92.817	N	N	N	N
vg0616962436	C -> A	LOC_Os06g29590.1	upstream_gene_variant ; 584.0bp to feature; MODIFIER	silent_mutation	Average:72.781; most accessible tissue: Callus, score: 92.817	N	N	N	N
vg0616962436	C -> A	LOC_Os06g29590-LOC_Os06g29600	intergenic_region ; MODIFIER	silent_mutation	Average:72.781; most accessible tissue: Callus, score: 92.817	N	N	N	N
vg0616962436	C -> DEL	N	N	silent_mutation	Average:72.781; most accessible tissue: Callus, score: 92.817	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616962436	NA	5.95E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	5.75E-06	5.74E-06	mr1849	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	NA	7.39E-08	mr1930	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	2.97E-07	NA	mr1070_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	3.38E-09	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	4.34E-10	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	2.34E-07	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	3.49E-07	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	2.25E-07	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	1.01E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	2.00E-07	NA	mr1145_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	2.53E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	1.20E-08	1.06E-09	mr1408_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	3.85E-06	NA	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	4.56E-06	NA	mr1878_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616962436	2.17E-06	NA	mr1949_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251