\
| Variant ID: vg0616953325 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 16953325 |
| Reference Allele: G | Alternative Allele: GTCA,A |
| Primary Allele: GTCA | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 204. )
AATTTGGATTGACCACATGTTTTTTTGATTGGCTGCAATTAATAAGCATGAAATAGGGACTGCATATGAATTTTGAACTGACTACAATAAAGCTATCTTC[G/GTCA,A]
TCATCAAGGGGAATGGCATCATTGTAATCTACCTTCCTTTTGTTTGACTTGTCAAGCTGCTCCAAATATGCATGCCACTTTGGTTGGTTTTTAAGTTCAT
ATGAACTTAAAAACCAACCAAAGTGGCATGCATATTTGGAGCAGCTTGACAAGTCAAACAAAAGGAAGGTAGATTACAATGATGCCATTCCCCTTGATGA[C/TGAC,T]
GAAGATAGCTTTATTGTAGTCAGTTCAAAATTCATATGCAGTCCCTATTTCATGCTTATTAATTGCAGCCAATCAAAAAAACATGTGGTCAATCCAAATT
| Populations | Population Size | Frequency of GTCA(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 29.40% | 0.08% | 0.00% | A: 5.99% |
| All Indica | 2759 | 97.60% | 1.70% | 0.04% | 0.00% | A: 0.58% |
| All Japonica | 1512 | 2.80% | 86.60% | 0.00% | 0.00% | A: 10.65% |
| Aus | 269 | 91.40% | 1.90% | 0.00% | 0.00% | A: 6.69% |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.10% | 0.00% | 0.00% | A: 1.51% |
| Indica III | 913 | 99.20% | 0.20% | 0.11% | 0.00% | A: 0.44% |
| Indica Intermediate | 786 | 96.10% | 3.30% | 0.00% | 0.00% | A: 0.64% |
| Temperate Japonica | 767 | 3.50% | 96.20% | 0.00% | 0.00% | A: 0.26% |
| Tropical Japonica | 504 | 2.00% | 70.00% | 0.00% | 0.00% | A: 27.98% |
| Japonica Intermediate | 241 | 2.10% | 90.50% | 0.00% | 0.00% | A: 7.47% |
| VI/Aromatic | 96 | 17.70% | 1.00% | 0.00% | 0.00% | A: 81.25% |
| Intermediate | 90 | 55.60% | 30.00% | 3.33% | 0.00% | A: 11.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616953325 | G -> A | LOC_Os06g29580.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.505; most accessible tissue: Callus, score: 61.918 | N | N | N | N |
| vg0616953325 | G -> GTCA | LOC_Os06g29580.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.505; most accessible tissue: Callus, score: 61.918 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616953325 | NA | 7.12E-08 | mr1930 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 8.58E-07 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 1.93E-09 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 2.25E-10 | NA | mr1083_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 4.50E-07 | NA | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 1.59E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 7.62E-07 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 1.89E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 2.48E-07 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 1.29E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616953325 | 3.52E-08 | 3.24E-09 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |