Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616757478:

Variant ID: vg0616757478 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16757478
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACCGAAGATAATAAAGATGAAGTCGCTCCACCATGATGACAAAGTTGTGTTGCCGTGATGAAGTGAACCGGTAGTGAAGACGCGCAGTTGTGAAGATAA[A/T]
AGCACCAGTCGACGGCGGCATAACACAAGTCGGCGGCGGAAGACGATGATGTCCATCAGTAGTGGTAGCTGTATAAACCAGATGTAGAGGCGAGGGCACT

Reverse complement sequence

AGTGCCCTCGCCTCTACATCTGGTTTATACAGCTACCACTACTGATGGACATCATCGTCTTCCGCCGCCGACTTGTGTTATGCCGCCGTCGACTGGTGCT[T/A]
TTATCTTCACAACTGCGCGTCTTCACTACCGGTTCACTTCATCACGGCAACACAACTTTGTCATCATGGTGGAGCGACTTCATCTTTATTATCTTCGGTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.10%	34.40%	19.78%	7.70%	NA
All Indica	2759	61.40%	4.30%	24.10%	10.22%	NA
All Japonica	1512	2.80%	91.40%	5.42%	0.33%	NA
Aus	269	11.50%	7.80%	54.28%	26.39%	NA
Indica I	595	37.30%	4.20%	41.34%	17.14%	NA
Indica II	465	47.30%	3.90%	29.68%	19.14%	NA
Indica III	913	86.00%	2.20%	11.39%	0.44%	NA
Indica Intermediate	786	59.30%	7.10%	22.52%	11.07%	NA
Temperate Japonica	767	2.20%	96.70%	0.65%	0.39%	NA
Tropical Japonica	504	4.80%	82.70%	12.30%	0.20%	NA
Japonica Intermediate	241	0.80%	92.50%	6.22%	0.41%	NA
VI/Aromatic	96	12.50%	62.50%	23.96%	1.04%	NA
Intermediate	90	25.60%	47.80%	21.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616757478	A -> T	LOC_Os06g29340.1	upstream_gene_variant ; 4966.0bp to feature; MODIFIER	silent_mutation	Average:7.516; most accessible tissue: Callus, score: 14.631	N	N	N	N
vg0616757478	A -> T	LOC_Os06g29330.1	downstream_gene_variant ; 103.0bp to feature; MODIFIER	silent_mutation	Average:7.516; most accessible tissue: Callus, score: 14.631	N	N	N	N
vg0616757478	A -> T	LOC_Os06g29320-LOC_Os06g29330	intergenic_region ; MODIFIER	silent_mutation	Average:7.516; most accessible tissue: Callus, score: 14.631	N	N	N	N
vg0616757478	A -> DEL	N	N	silent_mutation	Average:7.516; most accessible tissue: Callus, score: 14.631	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616757478	NA	4.84E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.52E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	2.49E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	4.63E-11	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	2.12E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	9.07E-06	mr1209_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	7.82E-10	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.95E-14	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	8.07E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	4.81E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.08E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	6.75E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	3.44E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.93E-10	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	1.05E-06	NA	mr1381_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	5.21E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.70E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	5.21E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.45E-10	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	1.81E-06	NA	mr1612_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	3.88E-06	mr1704_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	7.34E-06	8.24E-06	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	9.66E-06	NA	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	4.16E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	7.42E-06	3.38E-11	mr1885_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	8.29E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478	NA	1.52E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251