\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616757478:

Variant ID: vg0616757478 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16757478
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCGAAGATAATAAAGATGAAGTCGCTCCACCATGATGACAAAGTTGTGTTGCCGTGATGAAGTGAACCGGTAGTGAAGACGCGCAGTTGTGAAGATAA[A/T]
AGCACCAGTCGACGGCGGCATAACACAAGTCGGCGGCGGAAGACGATGATGTCCATCAGTAGTGGTAGCTGTATAAACCAGATGTAGAGGCGAGGGCACT

Reverse complement sequence

AGTGCCCTCGCCTCTACATCTGGTTTATACAGCTACCACTACTGATGGACATCATCGTCTTCCGCCGCCGACTTGTGTTATGCCGCCGTCGACTGGTGCT[T/A]
TTATCTTCACAACTGCGCGTCTTCACTACCGGTTCACTTCATCACGGCAACACAACTTTGTCATCATGGTGGAGCGACTTCATCTTTATTATCTTCGGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 34.40% 19.78% 7.70% NA
All Indica  2759 61.40% 4.30% 24.10% 10.22% NA
All Japonica  1512 2.80% 91.40% 5.42% 0.33% NA
Aus  269 11.50% 7.80% 54.28% 26.39% NA
Indica I  595 37.30% 4.20% 41.34% 17.14% NA
Indica II  465 47.30% 3.90% 29.68% 19.14% NA
Indica III  913 86.00% 2.20% 11.39% 0.44% NA
Indica Intermediate  786 59.30% 7.10% 22.52% 11.07% NA
Temperate Japonica  767 2.20% 96.70% 0.65% 0.39% NA
Tropical Japonica  504 4.80% 82.70% 12.30% 0.20% NA
Japonica Intermediate  241 0.80% 92.50% 6.22% 0.41% NA
VI/Aromatic  96 12.50% 62.50% 23.96% 1.04% NA
Intermediate  90 25.60% 47.80% 21.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616757478 A -> T LOC_Os06g29340.1 upstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:7.516; most accessible tissue: Callus, score: 14.631 N N N N
vg0616757478 A -> T LOC_Os06g29330.1 downstream_gene_variant ; 103.0bp to feature; MODIFIER silent_mutation Average:7.516; most accessible tissue: Callus, score: 14.631 N N N N
vg0616757478 A -> T LOC_Os06g29320-LOC_Os06g29330 intergenic_region ; MODIFIER silent_mutation Average:7.516; most accessible tissue: Callus, score: 14.631 N N N N
vg0616757478 A -> DEL N N silent_mutation Average:7.516; most accessible tissue: Callus, score: 14.631 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616757478 NA 4.84E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.52E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 2.49E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 4.63E-11 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 2.12E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 9.07E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 7.82E-10 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.95E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 8.07E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 4.81E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.08E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 6.75E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 3.44E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.93E-10 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 1.05E-06 NA mr1381_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 5.21E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.70E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 5.21E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.45E-10 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 1.81E-06 NA mr1612_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 3.88E-06 mr1704_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 7.34E-06 8.24E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 9.66E-06 NA mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 4.16E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 7.42E-06 3.38E-11 mr1885_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 8.29E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616757478 NA 1.52E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251