\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616753926:

Variant ID: vg0616753926 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 16753926
Reference Allele: TAlternative Allele: TA,A,TAA
Primary Allele: TASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCCGTTACACCATCTACATATATGCGTTCAGCTTTTTTGCTTGCGAAAGTTTTAAGCATTCGCACGATTGAAAACAGATGTAGTGGCTCCCACTACTT[T/TA,A,TAA]
AAAAAACTGTTTTTGCTAGCGTCCAAAATGGGTTTTTCACATATGGTTTATTTGCATGATCTGGTGCGTACGTACAGGATACTATCAAAAGAAAGCATTA

Reverse complement sequence

TAATGCTTTCTTTTGATAGTATCCTGTACGTACGCACCAGATCATGCAAATAAACCATATGTGAAAAACCCATTTTGGACGCTAGCAAAAACAGTTTTTT[A/TA,T,TTA]
AAGTAGTGGGAGCCACTACATCTGTTTTCAATCGTGCGAATGCTTAAAACTTTCGCAAGCAAAAAAGCTGAACGCATATATGTAGATGGTGTAACGGGCA

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 30.90% 0.00% 0.00% A: 9.54%; TAA: 0.02%
All Indica  2759 96.20% 1.90% 0.00% 0.00% A: 1.85%; TAA: 0.04%
All Japonica  1512 2.60% 90.80% 0.00% 0.00% A: 6.55%
Aus  269 24.20% 1.10% 0.00% 0.00% A: 74.72%
Indica I  595 93.80% 2.70% 0.00% 0.00% A: 3.53%
Indica II  465 97.20% 1.10% 0.00% 0.00% A: 1.72%
Indica III  913 99.20% 0.30% 0.00% 0.00% A: 0.33%; TAA: 0.11%
Indica Intermediate  786 94.00% 3.60% 0.00% 0.00% A: 2.42%
Temperate Japonica  767 3.50% 96.30% 0.00% 0.00% A: 0.13%
Tropical Japonica  504 1.60% 81.90% 0.00% 0.00% A: 16.47%
Japonica Intermediate  241 2.10% 91.70% 0.00% 0.00% A: 6.22%
VI/Aromatic  96 12.50% 1.00% 0.00% 0.00% A: 86.46%
Intermediate  90 46.70% 34.40% 0.00% 0.00% A: 18.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616753926 T -> A LOC_Os06g29320.1 downstream_gene_variant ; 2860.0bp to feature; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> A LOC_Os06g29330.1 downstream_gene_variant ; 3655.0bp to feature; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> A LOC_Os06g29320-LOC_Os06g29330 intergenic_region ; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> TA LOC_Os06g29320.1 downstream_gene_variant ; 2861.0bp to feature; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> TA LOC_Os06g29330.1 downstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> TA LOC_Os06g29320-LOC_Os06g29330 intergenic_region ; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> TAA LOC_Os06g29320.1 downstream_gene_variant ; 2861.0bp to feature; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> TAA LOC_Os06g29330.1 downstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N
vg0616753926 T -> TAA LOC_Os06g29320-LOC_Os06g29330 intergenic_region ; MODIFIER silent_mutation Average:76.754; most accessible tissue: Callus, score: 94.106 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0616753926 T A -0.01 0.0 -0.01 -0.01 -0.01 -0.02
vg0616753926 T TA 0.31 0.26 0.11 0.12 0.14 0.1
vg0616753926 T TAA 0.31 0.3 0.14 0.19 0.2 0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616753926 NA 3.37E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 1.93E-16 mr1522 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 1.84E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 2.52E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 5.71E-09 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 5.39E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 3.77E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926 NA 4.17E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251