\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616731072:

Variant ID: vg0616731072 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16731072
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTAGTCGCAATATGTGCAATTAGTTATTTTTTAGTCTATATTTAATACTTCATGCAGGTGTTCAAATGTTCGATGTGACAGTGAAAAATTTTAGGGT[G/A]
GGATCTAAACAAGGCCTAAATTTAGTACCTAGCATTGCCCGGATTCATATAGATATTAATGAATCTAGACCTCATTAGATTCATTGAATGATATGCGATT

Reverse complement sequence

AATCGCATATCATTCAATGAATCTAATGAGGTCTAGATTCATTAATATCTATATGAATCCGGGCAATGCTAGGTACTAAATTTAGGCCTTGTTTAGATCC[C/T]
ACCCTAAAATTTTTCACTGTCACATCGAACATTTGAACACCTGCATGAAGTATTAAATATAGACTAAAAAATAACTAATTGCACATATTGCGACTAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.20% 0.30% 0.00% NA
All Indica  2759 99.50% 0.50% 0.04% 0.00% NA
All Japonica  1512 93.30% 6.00% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.10% 0.13% 0.00% NA
Temperate Japonica  767 98.40% 1.20% 0.39% 0.00% NA
Tropical Japonica  504 84.30% 14.30% 1.39% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616731072 G -> A LOC_Os06g29300.1 upstream_gene_variant ; 3532.0bp to feature; MODIFIER silent_mutation Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0616731072 G -> A LOC_Os06g29310.1 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0616731072 G -> A LOC_Os06g29310.2 downstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0616731072 G -> A LOC_Os06g29300-LOC_Os06g29310 intergenic_region ; MODIFIER silent_mutation Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616731072 NA 4.31E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616731072 NA 2.64E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616731072 NA 2.55E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616731072 NA 8.42E-17 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616731072 2.73E-06 8.51E-08 mr1951_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251