Variant ID: vg0616731072 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 16731072 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATTAGTCGCAATATGTGCAATTAGTTATTTTTTAGTCTATATTTAATACTTCATGCAGGTGTTCAAATGTTCGATGTGACAGTGAAAAATTTTAGGGT[G/A]
GGATCTAAACAAGGCCTAAATTTAGTACCTAGCATTGCCCGGATTCATATAGATATTAATGAATCTAGACCTCATTAGATTCATTGAATGATATGCGATT
AATCGCATATCATTCAATGAATCTAATGAGGTCTAGATTCATTAATATCTATATGAATCCGGGCAATGCTAGGTACTAAATTTAGGCCTTGTTTAGATCC[C/T]
ACCCTAAAATTTTTCACTGTCACATCGAACATTTGAACACCTGCATGAAGTATTAAATATAGACTAAAAAATAACTAATTGCACATATTGCGACTAATTT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.50% | 2.20% | 0.30% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.50% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 93.30% | 6.00% | 0.79% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 98.40% | 1.20% | 0.39% | 0.00% | NA |
Tropical Japonica | 504 | 84.30% | 14.30% | 1.39% | 0.00% | NA |
Japonica Intermediate | 241 | 95.40% | 3.70% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0616731072 | G -> A | LOC_Os06g29300.1 | upstream_gene_variant ; 3532.0bp to feature; MODIFIER | silent_mutation | Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
vg0616731072 | G -> A | LOC_Os06g29310.1 | downstream_gene_variant ; 1852.0bp to feature; MODIFIER | silent_mutation | Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
vg0616731072 | G -> A | LOC_Os06g29310.2 | downstream_gene_variant ; 1855.0bp to feature; MODIFIER | silent_mutation | Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
vg0616731072 | G -> A | LOC_Os06g29300-LOC_Os06g29310 | intergenic_region ; MODIFIER | silent_mutation | Average:35.095; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0616731072 | NA | 4.31E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616731072 | NA | 2.64E-09 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616731072 | NA | 2.55E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616731072 | NA | 8.42E-17 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616731072 | 2.73E-06 | 8.51E-08 | mr1951_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |