Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616573493:

Variant ID: vg0616573493 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16573493
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGTCCCGAGAATGCAAACCACCATAACAAGTTTTACCTCTTCGCCGGAGATCGAAACCGATGCAGCTCCACTCAAAAGCAAGAACTCGTCGAAAACAA[C/T]
GAAAGTAGAAAAAGGTTGGCGATGCGCTGAAAGTATTATTGAACTGATGTTGTTTGTTTACAAGGTCTTGGGTCATATTTATACCCGAAATACATAATAT

Reverse complement sequence

ATATTATGTATTTCGGGTATAAATATGACCCAAGACCTTGTAAACAAACAACATCAGTTCAATAATACTTTCAGCGCATCGCCAACCTTTTTCTACTTTC[G/A]
TTGTTTTCGACGAGTTCTTGCTTTTGAGTGGAGCTGCATCGGTTTCGATCTCCGGCGAAGAGGTAAAACTTGTTATGGTGGTTTGCATTCTCGGGACTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 32.20% 0.53% 0.06% NA
All Indica  2759 49.40% 49.90% 0.69% 0.04% NA
All Japonica  1512 94.60% 5.20% 0.26% 0.00% NA
Aus  269 89.20% 10.40% 0.00% 0.37% NA
Indica I  595 18.30% 81.70% 0.00% 0.00% NA
Indica II  465 26.20% 72.70% 1.08% 0.00% NA
Indica III  913 85.10% 14.50% 0.44% 0.00% NA
Indica Intermediate  786 45.00% 53.60% 1.27% 0.13% NA
Temperate Japonica  767 97.80% 2.10% 0.13% 0.00% NA
Tropical Japonica  504 88.70% 10.70% 0.60% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 65.60% 31.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616573493 C -> T LOC_Os06g29070.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:38.419; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0616573493 C -> T LOC_Os06g29060-LOC_Os06g29070 intergenic_region ; MODIFIER silent_mutation Average:38.419; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0616573493 C -> DEL N N silent_mutation Average:38.419; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616573493 NA 1.42E-11 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 2.64E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 2.26E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.11E-40 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 9.03E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 7.30E-10 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.71E-18 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.81E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.34E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 2.49E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 6.45E-23 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 6.47E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.95E-08 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.22E-24 mr1583 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.76E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.43E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.69E-11 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.28E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 6.45E-13 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 7.74E-50 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.90E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.13E-12 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 3.31E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.87E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 5.17E-26 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.50E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 8.07E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 6.26E-13 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 6.02E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.65E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.20E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.59E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.42E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.94E-18 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 7.75E-12 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 1.44E-07 1.26E-22 mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.28E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 1.33E-07 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 5.64E-25 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616573493 NA 4.51E-09 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251