\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616527806:

Variant ID: vg0616527806 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16527806
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTCAGTTTCTGTTGAAAAAAAAACATAAGAAAAAAAAGAAAAGGGCAGAAAGCTGCAAAGAAAAAGAAAGAAAAAAGGCGCACCAAAAAAAAAGAAAA[A/T]
AAAGGTAGAAAGGTGCTTAGAAAAAAGCCGCACCAAGAAAAAAGAAAGAGAAAAAAAGAAAAATCATTCATCCTTTGAGTATGTTTTGAGAGTGCAGAGT

Reverse complement sequence

ACTCTGCACTCTCAAAACATACTCAAAGGATGAATGATTTTTCTTTTTTTCTCTTTCTTTTTTCTTGGTGCGGCTTTTTTCTAAGCACCTTTCTACCTTT[T/A]
TTTTCTTTTTTTTTGGTGCGCCTTTTTTCTTTCTTTTTCTTTGCAGCTTTCTGCCCTTTTCTTTTTTTTCTTATGTTTTTTTTTCAACAGAAACTGACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 30.10% 0.89% 29.67% NA
All Indica  2759 4.60% 48.70% 0.69% 46.03% NA
All Japonica  1512 97.50% 1.20% 0.07% 1.26% NA
Aus  269 76.20% 10.40% 0.37% 13.01% NA
Indica I  595 6.90% 79.50% 0.34% 13.28% NA
Indica II  465 3.40% 71.40% 0.86% 24.30% NA
Indica III  913 1.60% 13.80% 0.88% 83.68% NA
Indica Intermediate  786 6.90% 52.50% 0.64% 39.95% NA
Temperate Japonica  767 96.90% 1.60% 0.00% 1.56% NA
Tropical Japonica  504 98.60% 0.60% 0.00% 0.79% NA
Japonica Intermediate  241 97.10% 1.20% 0.41% 1.24% NA
VI/Aromatic  96 9.40% 11.50% 17.71% 61.46% NA
Intermediate  90 50.00% 24.40% 4.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616527806 A -> T LOC_Os06g28990.1 upstream_gene_variant ; 1777.0bp to feature; MODIFIER silent_mutation Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0616527806 A -> T LOC_Os06g29000.1 upstream_gene_variant ; 504.0bp to feature; MODIFIER silent_mutation Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0616527806 A -> T LOC_Os06g28990-LOC_Os06g29000 intergenic_region ; MODIFIER silent_mutation Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0616527806 A -> DEL N N silent_mutation Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616527806 NA 1.16E-07 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 1.51E-39 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 8.72E-44 mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 7.95E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 3.16E-46 mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 1.59E-29 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 2.06E-09 mr1242 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 4.17E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 3.83E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 2.57E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 5.33E-08 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 5.72E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 1.77E-25 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 6.00E-63 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 1.39E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 1.21E-48 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 1.73E-57 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 4.65E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 4.35E-60 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 8.76E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 3.83E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 3.76E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 9.61E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616527806 NA 3.30E-23 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251