\
| Variant ID: vg0616527806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16527806 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 96. )
TGGTCAGTTTCTGTTGAAAAAAAAACATAAGAAAAAAAAGAAAAGGGCAGAAAGCTGCAAAGAAAAAGAAAGAAAAAAGGCGCACCAAAAAAAAAGAAAA[A/T]
AAAGGTAGAAAGGTGCTTAGAAAAAAGCCGCACCAAGAAAAAAGAAAGAGAAAAAAAGAAAAATCATTCATCCTTTGAGTATGTTTTGAGAGTGCAGAGT
ACTCTGCACTCTCAAAACATACTCAAAGGATGAATGATTTTTCTTTTTTTCTCTTTCTTTTTTCTTGGTGCGGCTTTTTTCTAAGCACCTTTCTACCTTT[T/A]
TTTTCTTTTTTTTTGGTGCGCCTTTTTTCTTTCTTTTTCTTTGCAGCTTTCTGCCCTTTTCTTTTTTTTCTTATGTTTTTTTTTCAACAGAAACTGACCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.30% | 30.10% | 0.89% | 29.67% | NA |
| All Indica | 2759 | 4.60% | 48.70% | 0.69% | 46.03% | NA |
| All Japonica | 1512 | 97.50% | 1.20% | 0.07% | 1.26% | NA |
| Aus | 269 | 76.20% | 10.40% | 0.37% | 13.01% | NA |
| Indica I | 595 | 6.90% | 79.50% | 0.34% | 13.28% | NA |
| Indica II | 465 | 3.40% | 71.40% | 0.86% | 24.30% | NA |
| Indica III | 913 | 1.60% | 13.80% | 0.88% | 83.68% | NA |
| Indica Intermediate | 786 | 6.90% | 52.50% | 0.64% | 39.95% | NA |
| Temperate Japonica | 767 | 96.90% | 1.60% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 98.60% | 0.60% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 9.40% | 11.50% | 17.71% | 61.46% | NA |
| Intermediate | 90 | 50.00% | 24.40% | 4.44% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616527806 | A -> T | LOC_Os06g28990.1 | upstream_gene_variant ; 1777.0bp to feature; MODIFIER | silent_mutation | Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0616527806 | A -> T | LOC_Os06g29000.1 | upstream_gene_variant ; 504.0bp to feature; MODIFIER | silent_mutation | Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0616527806 | A -> T | LOC_Os06g28990-LOC_Os06g29000 | intergenic_region ; MODIFIER | silent_mutation | Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0616527806 | A -> DEL | N | N | silent_mutation | Average:19.566; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616527806 | NA | 1.16E-07 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 1.51E-39 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 8.72E-44 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 7.95E-28 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 3.16E-46 | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 1.59E-29 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 2.06E-09 | mr1242 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 4.17E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 3.83E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 2.57E-42 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 5.33E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 5.72E-17 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 1.77E-25 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 6.00E-63 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 1.39E-10 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 1.21E-48 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 1.73E-57 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 4.65E-10 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 4.35E-60 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 8.76E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 3.83E-08 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 3.76E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 9.61E-10 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616527806 | NA | 3.30E-23 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |