Variant ID: vg0616167039 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 16167039 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTACTGTTTTACAATTTTTACTATTTGCTAAATGCTTCTTTTGCAAATGAACCCTATATTATGCCATTCTTTGGTATCCTTGTGCACTTGCATATTTG[C/T]
TGTGTGGCTTGCTGAGTATGTCATATGCTCACCTTGCTATAATCAATCAAACCTCAGTTGAAAACAAGTTGCGAAGGAGAAGACGTTTGGCTTATACCCC
GGGGTATAAGCCAAACGTCTTCTCCTTCGCAACTTGTTTTCAACTGAGGTTTGATTGATTATAGCAAGGTGAGCATATGACATACTCAGCAAGCCACACA[G/A]
CAAATATGCAAGTGCACAAGGATACCAAAGAATGGCATAATATAGGGTTCATTTGCAAAAGAAGCATTTAGCAAATAGTAAAAATTGTAAAACAGTAGAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.10% | 4.30% | 2.33% | 1.25% | NA |
All Indica | 2759 | 99.50% | 0.30% | 0.11% | 0.07% | NA |
All Japonica | 1512 | 94.60% | 0.10% | 5.16% | 0.20% | NA |
Aus | 269 | 30.50% | 68.80% | 0.74% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.10% | 0.11% | 0.11% | NA |
Indica Intermediate | 786 | 99.00% | 0.80% | 0.13% | 0.13% | NA |
Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 86.30% | 0.20% | 13.29% | 0.20% | NA |
Japonica Intermediate | 241 | 95.00% | 0.00% | 4.15% | 0.83% | NA |
VI/Aromatic | 96 | 18.80% | 4.20% | 26.04% | 51.04% | NA |
Intermediate | 90 | 84.40% | 7.80% | 2.22% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0616167039 | C -> T | LOC_Os06g28410.1 | downstream_gene_variant ; 2519.0bp to feature; MODIFIER | silent_mutation | Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
vg0616167039 | C -> T | LOC_Os06g28420.1 | downstream_gene_variant ; 1754.0bp to feature; MODIFIER | silent_mutation | Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
vg0616167039 | C -> T | LOC_Os06g28410-LOC_Os06g28420 | intergenic_region ; MODIFIER | silent_mutation | Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
vg0616167039 | C -> DEL | N | N | silent_mutation | Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0616167039 | NA | 2.20E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 1.07E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 2.80E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 7.17E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | 4.55E-06 | 2.28E-07 | mr1467 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 1.38E-08 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 7.17E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 3.29E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 1.43E-07 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 1.36E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 8.03E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0616167039 | NA | 1.17E-06 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |