\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616167039:

Variant ID: vg0616167039 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16167039
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTACTGTTTTACAATTTTTACTATTTGCTAAATGCTTCTTTTGCAAATGAACCCTATATTATGCCATTCTTTGGTATCCTTGTGCACTTGCATATTTG[C/T]
TGTGTGGCTTGCTGAGTATGTCATATGCTCACCTTGCTATAATCAATCAAACCTCAGTTGAAAACAAGTTGCGAAGGAGAAGACGTTTGGCTTATACCCC

Reverse complement sequence

GGGGTATAAGCCAAACGTCTTCTCCTTCGCAACTTGTTTTCAACTGAGGTTTGATTGATTATAGCAAGGTGAGCATATGACATACTCAGCAAGCCACACA[G/A]
CAAATATGCAAGTGCACAAGGATACCAAAGAATGGCATAATATAGGGTTCATTTGCAAAAGAAGCATTTAGCAAATAGTAAAAATTGTAAAACAGTAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 4.30% 2.33% 1.25% NA
All Indica  2759 99.50% 0.30% 0.11% 0.07% NA
All Japonica  1512 94.60% 0.10% 5.16% 0.20% NA
Aus  269 30.50% 68.80% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 99.00% 0.80% 0.13% 0.13% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 86.30% 0.20% 13.29% 0.20% NA
Japonica Intermediate  241 95.00% 0.00% 4.15% 0.83% NA
VI/Aromatic  96 18.80% 4.20% 26.04% 51.04% NA
Intermediate  90 84.40% 7.80% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616167039 C -> T LOC_Os06g28410.1 downstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0616167039 C -> T LOC_Os06g28420.1 downstream_gene_variant ; 1754.0bp to feature; MODIFIER silent_mutation Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0616167039 C -> T LOC_Os06g28410-LOC_Os06g28420 intergenic_region ; MODIFIER silent_mutation Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0616167039 C -> DEL N N silent_mutation Average:26.008; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616167039 NA 2.20E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 1.07E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 2.80E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 7.17E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 4.55E-06 2.28E-07 mr1467 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 1.38E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 7.17E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 3.29E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 1.43E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 1.36E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 8.03E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616167039 NA 1.17E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251