Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0616107808:

Variant ID: vg0616107808 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16107808
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCCGGGCCTGCAGTCCATTGTTGCTGCCCGCCGAACGAGGTCGATCGTGACCTTCGCCACCCCAGAGAAGGGACGTTGCAGCATTGTTTGCATAAGTG[T/C]
ACAACCTACTATCCTATCAAATCAAATATCATCATGAGTGCTGACTTACATAACGAATCGAGAGCTCAAAATACAAGAACTAAAAATAGATCAAATCCAG

Reverse complement sequence

CTGGATTTGATCTATTTTTAGTTCTTGTATTTTGAGCTCTCGATTCGTTATGTAAGTCAGCACTCATGATGATATTTGATTTGATAGGATAGTAGGTTGT[A/G]
CACTTATGCAAACAATGCTGCAACGTCCCTTCTCTGGGGTGGCGAAGGTCACGATCGACCTCGTTCGGCGGGCAGCAACAATGGACTGCAGGCCCGGCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 0.30% 2.01% 27.17% NA
All Indica  2759 52.30% 0.40% 3.37% 43.93% NA
All Japonica  1512 98.90% 0.00% 0.00% 1.06% NA
Aus  269 89.60% 0.00% 0.00% 10.41% NA
Indica I  595 21.70% 1.30% 8.74% 68.24% NA
Indica II  465 32.30% 0.00% 3.87% 63.87% NA
Indica III  913 84.80% 0.00% 0.11% 15.12% NA
Indica Intermediate  786 49.70% 0.30% 2.80% 47.20% NA
Temperate Japonica  767 98.70% 0.00% 0.00% 1.30% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 89.60% 0.00% 0.00% 10.42% NA
Intermediate  90 74.40% 3.30% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616107808 T -> C LOC_Os06g28340.1 missense_variant ; p.Tyr877Cys; MODERATE nonsynonymous_codon ; Y877C Average:82.268; most accessible tissue: Minghui63 flag leaf, score: 93.756 unknown unknown DELETERIOUS 0.00
vg0616107808 T -> DEL LOC_Os06g28340.1 N frameshift_variant Average:82.268; most accessible tissue: Minghui63 flag leaf, score: 93.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0616107808 T C -0.07 -0.07 -0.04 -0.04 -0.08 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616107808 NA 1.30E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616107808 NA 6.22E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616107808 NA 9.18E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616107808 2.65E-06 2.65E-06 mr1812_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616107808 6.77E-06 6.77E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616107808 5.17E-06 5.17E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616107808 NA 5.28E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251