\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616045271:

Variant ID: vg0616045271 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 16045271
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAATTGTCAAATTCAAGACTTGAACCCATGACCTCATAGTTCAAAGCACATTCTTCTAACCAATTCATCTAATGGTGCTATTTGTTTCAAGAATTTTG[T/C]
GAGAAAGTAATATGATTATCAATTCTAATATCTTTCACTACCGAAACTCATAACATGTTATTATGCTCTAGTAGTAACATTGTTGTATAAGTACAGTAAC

Reverse complement sequence

GTTACTGTACTTATACAACAATGTTACTACTAGAGCATAATAACATGTTATGAGTTTCGGTAGTGAAAGATATTAGAATTGATAATCATATTACTTTCTC[A/G]
CAAAATTCTTGAAACAAATAGCACCATTAGATGAATTGGTTAGAAGAATGTGCTTTGAACTATGAGGTCATGGGTTCAAGTCTTGAATTTGACAATTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 9.50% 44.33% 0.00% NA
All Indica  2759 23.20% 9.90% 66.87% 0.00% NA
All Japonica  1512 91.10% 1.00% 7.87% 0.00% NA
Aus  269 14.10% 52.80% 33.09% 0.00% NA
Indica I  595 9.40% 7.60% 83.03% 0.00% NA
Indica II  465 10.30% 16.10% 73.55% 0.00% NA
Indica III  913 40.50% 8.50% 50.93% 0.00% NA
Indica Intermediate  786 21.20% 9.50% 69.21% 0.00% NA
Temperate Japonica  767 96.20% 0.70% 3.13% 0.00% NA
Tropical Japonica  504 82.50% 2.00% 15.48% 0.00% NA
Japonica Intermediate  241 92.90% 0.00% 7.05% 0.00% NA
VI/Aromatic  96 84.40% 6.20% 9.38% 0.00% NA
Intermediate  90 51.10% 12.20% 36.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0616045271 T -> C LOC_Os06g28240.1 upstream_gene_variant ; 2060.0bp to feature; MODIFIER silent_mutation Average:32.05; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0616045271 T -> C LOC_Os06g28240-LOC_Os06g28250 intergenic_region ; MODIFIER silent_mutation Average:32.05; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0616045271 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 4.52E-06 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 6.33E-06 6.33E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 3.01E-07 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 9.41E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 5.79E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 5.14E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 1.00E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 6.28E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 3.23E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 4.61E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 2.00E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 2.72E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 6.67E-06 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 9.96E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 8.55E-06 NA mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 2.08E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 1.65E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 6.87E-06 3.83E-14 mr1781_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616045271 NA 6.59E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251