Search for Variation information by Variation ID:
Detailed information for vg0615850189:
| Variant ID: vg0615850189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15850189 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 295. )
Flanking Sequence (100 bp) in Reference Genome:
CCCGGTCCAATCTAGATCCAGAGAGATTGGCGTTATACTCCAACCTCTTGGGACAGTCTCGACGGAAGAGTTGGATGGCTACCTTAGCTCCCCGGGCGTC[A/T]
GTTCTCGACCAACCGAGATCCTCGACTACGACGACTTCGGTTACCACTGCGACCACGGCGACTTCAACGACTTCGATGACAGCTATAAGGATAACTACAC
Reverse complement sequence
GTGTAGTTATCCTTATAGCTGTCATCGAAGTCGTTGAAGTCGCCGTGGTCGCAGTGGTAACCGAAGTCGTCGTAGTCGAGGATCTCGGTTGGTCGAGAAC[T/A]
GACGCCCGGGGAGCTAAGGTAGCCATCCAACTCTTCCGTCGAGACTGTCCCAAGAGGTTGGAGTATAACGCCAATCTCTCTGGATCTAGATTGGACCGGG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.30% | 3.10% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 4.90% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.80% | 8.60% | 2.58% | 0.00% | NA |
| Indica III | 913 | 94.00% | 5.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 5.10% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615850189 | A -> T | LOC_Os06g27930.1 | missense_variant ; p.Ser157Cys; MODERATE | nonsynonymous_codon ; S157C | Average:67.541; most accessible tissue: Minghui63 flag leaf, score: 82.75 | probably damaging  |
2.965 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615850189 | 2.71E-06 | 1.14E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615850189 | 2.01E-06 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615850189 | 8.81E-07 | NA | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615850189 | 2.33E-06 | 7.86E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615850189 | 2.52E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615850189 | 5.64E-06 | 3.47E-06 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615850189 | 3.76E-06 | NA | mr1244_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |