Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615411425:

Variant ID: vg0615411425 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15411425
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

AATATAAAGTAGGTACTCATATACTCGGAAAGTATTTCAATACCATAAATGTATTTAGAAGAGTATTCTAATAAAAGTATAAAGCTTACAAAAGAGAAGA[G/T]
AAAAGCTACTAGAGCCATACCCGAACTCTTCCAAAGGCTTTCGGACCCCTGATTTCTACTCTATTCCTATTCCACCAGCTAGATACTACTAAACTAAACT

Reverse complement sequence

AGTTTAGTTTAGTAGTATCTAGCTGGTGGAATAGGAATAGAGTAGAAATCAGGGGTCCGAAAGCCTTTGGAAGAGTTCGGGTATGGCTCTAGTAGCTTTT[C/A]
TCTTCTCTTTTGTAAGCTTTATACTTTTATTAGAATACTCTTCTAAATACATTTATGGTATTGAAATACTTTCCGAGTATATGAGTACCTACTTTATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	30.80%	0.13%	0.08%	NA
All Indica	2759	50.10%	49.60%	0.18%	0.14%	NA
All Japonica	1512	98.70%	1.20%	0.07%	0.00%	NA
Aus	269	86.20%	13.80%	0.00%	0.00%	NA
Indica I	595	18.20%	81.70%	0.17%	0.00%	NA
Indica II	465	27.70%	71.60%	0.43%	0.22%	NA
Indica III	913	85.50%	14.30%	0.00%	0.11%	NA
Indica Intermediate	786	46.30%	53.20%	0.25%	0.25%	NA
Temperate Japonica	767	98.30%	1.60%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615411425	G -> T	LOC_Os06g26320.1	upstream_gene_variant ; 1283.0bp to feature; MODIFIER	silent_mutation	Average:44.778; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0615411425	G -> T	LOC_Os06g26330.1	upstream_gene_variant ; 1709.0bp to feature; MODIFIER	silent_mutation	Average:44.778; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0615411425	G -> T	LOC_Os06g26340.1	downstream_gene_variant ; 3404.0bp to feature; MODIFIER	silent_mutation	Average:44.778; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0615411425	G -> T	LOC_Os06g26340.2	downstream_gene_variant ; 3404.0bp to feature; MODIFIER	silent_mutation	Average:44.778; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0615411425	G -> T	LOC_Os06g26320-LOC_Os06g26330	intergenic_region ; MODIFIER	silent_mutation	Average:44.778; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N
vg0615411425	G -> DEL	N	N	silent_mutation	Average:44.778; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615411425	NA	1.80E-61	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	3.02E-49	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.00E-55	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.81E-50	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.81E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.19E-56	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.29E-45	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.56E-36	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.40E-52	mr1096	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.96E-49	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.84E-38	mr1110	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.88E-45	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	5.66E-49	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.72E-46	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.54E-43	mr1200	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.97E-07	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	8.13E-53	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	9.83E-36	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	9.38E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	2.75E-07	2.51E-06	mr1280	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	3.94E-07	3.02E-07	mr1297	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	2.98E-06	2.03E-06	mr1318	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.16E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	5.89E-44	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	5.86E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.23E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.51E-28	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.62E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	3.34E-65	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.25E-58	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	9.99E-50	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	5.67E-55	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.02E-60	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.94E-60	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.48E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	1.08E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	7.63E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	4.70E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.33E-24	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615411425	NA	2.38E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251