Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0615282894:

Variant ID: vg0615282894 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15282894
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCCAAGTGTCCATTTGGATGATGGTTGGAGCGCCGAAAACGGTCATAACCGTCATTAGGAAGCAGTTATCTACCGAACTGGACTTGGGCCGGGGCGAA[C/T]
GGCCTCTACCGGGGTTCGGCCGAACCCCTGAGTTCGGCTGAACCCGAGATAGCTCTGTTTGCTCCAGTTTTCGTCCCGGACACTCATTTTGGGCCCCTCA

Reverse complement sequence

TGAGGGGCCCAAAATGAGTGTCCGGGACGAAAACTGGAGCAAACAGAGCTATCTCGGGTTCAGCCGAACTCAGGGGTTCGGCCGAACCCCGGTAGAGGCC[G/A]
TTCGCCCCGGCCCAAGTCCAGTTCGGTAGATAACTGCTTCCTAATGACGGTTATGACCGTTTTCGGCGCTCCAACCATCATCCAAATGGACACTTGGCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 7.30% 2.29% 0.00% NA
All Indica  2759 84.30% 11.90% 3.81% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 96.00% 0.20% 3.87% 0.00% NA
Indica II  465 85.80% 10.10% 4.09% 0.00% NA
Indica III  913 74.60% 23.90% 1.53% 0.00% NA
Indica Intermediate  786 86.00% 7.80% 6.23% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615282894 C -> T LOC_Os06g26120.1 upstream_gene_variant ; 1241.0bp to feature; MODIFIER silent_mutation Average:57.439; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0615282894 C -> T LOC_Os06g26120-LOC_Os06g26130 intergenic_region ; MODIFIER silent_mutation Average:57.439; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615282894 1.70E-07 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 5.69E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 8.96E-08 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 8.26E-07 6.24E-10 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.90E-06 NA mr1094 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 2.26E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 6.23E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.09E-07 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.64E-08 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 7.22E-07 5.33E-10 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 NA 2.95E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 2.75E-07 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 3.78E-08 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 6.47E-07 6.15E-11 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 3.78E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 3.74E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.78E-06 5.82E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 4.89E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 5.98E-08 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.40E-06 3.78E-10 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 5.63E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.49E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 1.27E-07 1.62E-11 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615282894 NA 1.59E-06 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251