Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615248067:

Variant ID: vg0615248067 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15248067
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

TCTACCATTCTATGAGACTTCCAGCGGCTTGATTGTCTAGATATTATTCTTCTTTTCATACTTAATGTTGCATCAGTTGAGTTTTATCTATTAAGTTGTG[C/T]
TTAGAATATCAATCTCTAGTCTGCCTTCTGGTTGCCGATTAGGGTAGCATCGGAGTTTCAGCCGATCTTATCTGATTTAACTATATTTGCTCTATATGAT

Reverse complement sequence

ATCATATAGAGCAAATATAGTTAAATCAGATAAGATCGGCTGAAACTCCGATGCTACCCTAATCGGCAACCAGAAGGCAGACTAGAGATTGATATTCTAA[G/A]
CACAACTTAATAGATAAAACTCAACTGATGCAACATTAAGTATGAAAAGAAGAATAATATCTAGACAATCAAGCCGCTGGAAGTCTCATAGAATGGTAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	35.00%	0.47%	25.58%	NA
All Indica	2759	5.10%	52.60%	0.76%	41.54%	NA
All Japonica	1512	91.20%	7.60%	0.07%	1.12%	NA
Aus	269	70.30%	16.70%	0.00%	13.01%	NA
Indica I	595	4.00%	86.20%	0.00%	9.75%	NA
Indica II	465	4.70%	75.70%	0.22%	19.35%	NA
Indica III	913	2.70%	15.40%	1.53%	80.28%	NA
Indica Intermediate	786	8.80%	56.70%	0.76%	33.72%	NA
Temperate Japonica	767	96.50%	1.80%	0.13%	1.56%	NA
Tropical Japonica	504	82.30%	16.90%	0.00%	0.79%	NA
Japonica Intermediate	241	92.90%	6.60%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	32.20%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615248067	C -> T	LOC_Os06g26060.1	upstream_gene_variant ; 867.0bp to feature; MODIFIER	silent_mutation	Average:17.34; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0615248067	C -> T	LOC_Os06g26050-LOC_Os06g26060	intergenic_region ; MODIFIER	silent_mutation	Average:17.34; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0615248067	C -> DEL	N	N	silent_mutation	Average:17.34; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615248067	NA	1.02E-53	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	6.66E-08	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	4.91E-44	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	7.74E-17	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	2.38E-06	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.45E-46	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.49E-06	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	5.52E-16	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.47E-27	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	6.00E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	9.88E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	2.78E-23	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	5.39E-37	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.18E-08	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	3.00E-17	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	4.99E-06	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.08E-06	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	4.72E-07	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	6.24E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	9.03E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.19E-11	mr1781_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	1.40E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	3.29E-13	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	7.04E-26	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615248067	NA	8.92E-09	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251