\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615247267:

Variant ID: vg0615247267 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15247267
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATTTAAGTATATATCGACACAAGGATTATATATTGTTAATATTGTTAACGACCAAATTTGGTAATATCAGCATCGGAAAAGAGGATTAGATCGAAGC[G/A]
GAGTCAAAGGCGAAGATCGATTCGAGAACAGAGCAAGAATCGGCTGGACTCCAGATTGGCTACGATTAGGATCTGCTGGGTCCGAGTCGGACTGGGTAAG

Reverse complement sequence

CTTACCCAGTCCGACTCGGACCCAGCAGATCCTAATCGTAGCCAATCTGGAGTCCAGCCGATTCTTGCTCTGTTCTCGAATCGATCTTCGCCTTTGACTC[C/T]
GCTTCGATCTAATCCTCTTTTCCGATGCTGATATTACCAAATTTGGTCGTTAACAATATTAACAATATATAATCCTTGTGTCGATATATACTTAAATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 34.90% 1.27% 23.00% NA
All Indica  2759 7.90% 52.50% 2.17% 37.44% NA
All Japonica  1512 91.40% 7.70% 0.00% 0.93% NA
Aus  269 72.10% 16.70% 0.00% 11.15% NA
Indica I  595 5.40% 86.20% 0.17% 8.24% NA
Indica II  465 7.70% 75.50% 0.86% 15.91% NA
Indica III  913 6.70% 15.30% 3.50% 74.48% NA
Indica Intermediate  786 11.20% 56.60% 2.93% 29.26% NA
Temperate Japonica  767 96.90% 2.00% 0.00% 1.17% NA
Tropical Japonica  504 82.30% 16.90% 0.00% 0.79% NA
Japonica Intermediate  241 92.90% 6.60% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 56.70% 32.20% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615247267 G -> A LOC_Os06g26050.1 upstream_gene_variant ; 4500.0bp to feature; MODIFIER silent_mutation Average:23.996; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0615247267 G -> A LOC_Os06g26060.1 upstream_gene_variant ; 1667.0bp to feature; MODIFIER silent_mutation Average:23.996; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0615247267 G -> A LOC_Os06g26050-LOC_Os06g26060 intergenic_region ; MODIFIER silent_mutation Average:23.996; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0615247267 G -> DEL N N silent_mutation Average:23.996; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615247267 NA 6.75E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.42E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.65E-41 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 5.21E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 3.21E-16 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.46E-06 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 2.38E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 3.20E-27 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 2.87E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 7.79E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 5.33E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.31E-10 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 9.27E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 6.49E-23 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 9.01E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.32E-36 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 6.54E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 5.29E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 2.35E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.49E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.48E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 5.06E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 6.93E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 2.59E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 3.98E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.41E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.38E-26 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 4.34E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 NA 1.38E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615247267 7.13E-06 NA mr1965_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251