\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0615233212:

Variant ID: vg0615233212 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15233212
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAACACCCCTAGACAGTTTTAGTTAATCAATATCTCAATACTATACTCAACAGAAAAAAACCCAATGTTCCTGAAACATCCATGCATGATACACAACA[G/A]
TTATGCATGCCGCTCGCCAACACCCTATGGAATTGTCGCCCTCCATACTTGCCTTTGTCATGCCTTCTATTGTCCACCATGCCTCCAGTCCTCCACAACC

Reverse complement sequence

GGTTGTGGAGGACTGGAGGCATGGTGGACAATAGAAGGCATGACAAAGGCAAGTATGGAGGGCGACAATTCCATAGGGTGTTGGCGAGCGGCATGCATAA[C/T]
TGTTGTGTATCATGCATGGATGTTTCAGGAACATTGGGTTTTTTTCTGTTGAGTATAGTATTGAGATATTGATTAACTAAAACTGTCTAGGGGTGTTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.20% 0.61% 0.17% NA
All Indica  2759 96.50% 2.30% 0.98% 0.22% NA
All Japonica  1512 9.00% 90.90% 0.07% 0.07% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 96.00% 2.90% 1.18% 0.00% NA
Indica II  465 96.80% 2.60% 0.65% 0.00% NA
Indica III  913 99.00% 0.70% 0.22% 0.11% NA
Indica Intermediate  786 93.80% 3.70% 1.91% 0.64% NA
Temperate Japonica  767 3.40% 96.50% 0.13% 0.00% NA
Tropical Japonica  504 17.90% 81.90% 0.00% 0.20% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615233212 G -> A LOC_Os06g26010.1 downstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:63.634; most accessible tissue: Callus, score: 81.335 N N N N
vg0615233212 G -> A LOC_Os06g26020.1 downstream_gene_variant ; 1707.0bp to feature; MODIFIER silent_mutation Average:63.634; most accessible tissue: Callus, score: 81.335 N N N N
vg0615233212 G -> A LOC_Os06g26030.1 downstream_gene_variant ; 3153.0bp to feature; MODIFIER silent_mutation Average:63.634; most accessible tissue: Callus, score: 81.335 N N N N
vg0615233212 G -> A LOC_Os06g26010-LOC_Os06g26020 intergenic_region ; MODIFIER silent_mutation Average:63.634; most accessible tissue: Callus, score: 81.335 N N N N
vg0615233212 G -> DEL N N silent_mutation Average:63.634; most accessible tissue: Callus, score: 81.335 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615233212 NA 2.08E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.62E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 1.49E-12 9.81E-78 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 7.89E-07 1.83E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.60E-89 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.98E-81 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.64E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 9.75E-06 mr1091 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.45E-89 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.70E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 3.74E-07 1.18E-39 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 5.59E-06 1.34E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.25E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.45E-96 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.56E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.80E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.49E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.41E-90 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.00E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.74E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 1.17E-07 3.75E-75 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.46E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.18E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 3.47E-92 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.11E-65 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.67E-75 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 6.06E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.43E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.77E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.75E-34 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.28E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 8.14E-13 8.39E-102 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 1.24E-93 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 2.71E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 7.53E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 4.93E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 NA 4.83E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615233212 2.41E-06 2.41E-06 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251