\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615208926:

Variant ID: vg0615208926 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15208926
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACCAAAAGTTTAGTTTGCTTCGAAAAAGGACAGGTGTTTGGTATATACAAAAGGTGTTTTTTCCCAAACGGCATAAAGTAAAAAGTCTGGCGCTCGG[C/T]
CATGACGCTTACACACCCAGGAAGCTTTGGATGGCATTAATCGCATGCAGATGGATTTGATCTATCTCATCCAGATCTTGCTGATCTTGCTAGGTCACCC

Reverse complement sequence

GGGTGACCTAGCAAGATCAGCAAGATCTGGATGAGATAGATCAAATCCATCTGCATGCGATTAATGCCATCCAAAGCTTCCTGGGTGTGTAAGCGTCATG[G/A]
CCGAGCGCCAGACTTTTTACTTTATGCCGTTTGGGAAAAAACACCTTTTGTATATACCAAACACCTGTCCTTTTTCGAAGCAAACTAAACTTTTGGTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 7.60% 1.33% 0.00% NA
All Indica  2759 85.50% 12.30% 2.14% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.30% 0.70% 2.02% 0.00% NA
Indica II  465 87.30% 11.00% 1.72% 0.00% NA
Indica III  913 74.70% 24.10% 1.20% 0.00% NA
Indica Intermediate  786 88.20% 8.30% 3.56% 0.00% NA
Temperate Japonica  767 98.60% 1.20% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615208926 C -> T LOC_Os06g25970.1 downstream_gene_variant ; 241.0bp to feature; MODIFIER silent_mutation Average:60.908; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0615208926 C -> T LOC_Os06g25970-LOC_Os06g25980 intergenic_region ; MODIFIER silent_mutation Average:60.908; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615208926 1.44E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 6.99E-08 4.99E-10 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 6.01E-06 NA mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 3.01E-08 9.50E-11 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 NA 6.88E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 1.64E-06 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 2.75E-08 3.75E-11 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 7.28E-10 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 8.05E-11 3.48E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 8.50E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 1.39E-07 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 7.04E-10 7.45E-11 mr1121_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 2.94E-07 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 1.76E-08 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615208926 1.08E-10 4.10E-12 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251