\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615097742:

Variant ID: vg0615097742 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 15097742
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAGTAGCTTTCAAGTGCATTAGTCCAAGGTGTGGAAGATGGATGCTTGGAGACCCCCCAAAAAGTACAAAATCAAATCGGACTGGAACTCGAGAAGTG[T/C]
ATAGGATAGTTTATCTTCTGAAATCAACTTTTTAGGTAAAACTATACTATTAAGAGGGGTTCCAGGTGATGCTCTGAGATATATCAAATGCTCTTAGTGT

Reverse complement sequence

ACACTAAGAGCATTTGATATATCTCAGAGCATCACCTGGAACCCCTCTTAATAGTATAGTTTTACCTAAAAAGTTGATTTCAGAAGATAAACTATCCTAT[A/G]
CACTTCTCGAGTTCCAGTCCGATTTGATTTTGTACTTTTTGGGGGGTCTCCAAGCATCCATCTTCCACACCTTGGACTAATGCACTTGAAAGCTACTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 32.60% 3.26% 3.83% NA
All Indica  2759 93.80% 3.40% 1.49% 1.34% NA
All Japonica  1512 8.30% 91.00% 0.26% 0.46% NA
Aus  269 30.10% 3.00% 39.03% 27.88% NA
Indica I  595 93.30% 5.20% 1.18% 0.34% NA
Indica II  465 95.10% 1.70% 1.51% 1.72% NA
Indica III  913 95.80% 1.20% 1.42% 1.53% NA
Indica Intermediate  786 91.00% 5.60% 1.78% 1.65% NA
Temperate Japonica  767 2.70% 96.50% 0.26% 0.52% NA
Tropical Japonica  504 17.30% 82.10% 0.20% 0.40% NA
Japonica Intermediate  241 7.10% 92.10% 0.41% 0.41% NA
VI/Aromatic  96 16.70% 21.90% 3.12% 58.33% NA
Intermediate  90 45.60% 46.70% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0615097742 T -> C LOC_Os06g25840.1 upstream_gene_variant ; 454.0bp to feature; MODIFIER silent_mutation Average:21.448; most accessible tissue: Callus, score: 36.05 N N N N
vg0615097742 T -> C LOC_Os06g25850.1 upstream_gene_variant ; 1264.0bp to feature; MODIFIER silent_mutation Average:21.448; most accessible tissue: Callus, score: 36.05 N N N N
vg0615097742 T -> C LOC_Os06g25840-LOC_Os06g25850 intergenic_region ; MODIFIER silent_mutation Average:21.448; most accessible tissue: Callus, score: 36.05 N N N N
vg0615097742 T -> DEL N N silent_mutation Average:21.448; most accessible tissue: Callus, score: 36.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0615097742 NA 4.99E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 2.77E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 3.19E-07 3.19E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 4.52E-06 4.07E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 4.82E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 2.64E-06 3.13E-07 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 6.30E-06 6.30E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 7.93E-06 NA mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 8.87E-06 mr1208 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 8.20E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 2.26E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 6.70E-06 6.70E-06 mr1299 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 1.94E-08 1.13E-08 mr1438 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 2.85E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 2.83E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 1.68E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 1.70E-06 2.27E-07 mr1626 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 1.30E-06 7.46E-08 mr1631 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 7.86E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 1.26E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 2.79E-07 5.64E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 8.98E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 4.52E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 6.61E-06 NA mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742 NA 1.62E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251