Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0615097742:

Variant ID: vg0615097742 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 15097742
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAGTAGCTTTCAAGTGCATTAGTCCAAGGTGTGGAAGATGGATGCTTGGAGACCCCCCAAAAAGTACAAAATCAAATCGGACTGGAACTCGAGAAGTG[T/C]
ATAGGATAGTTTATCTTCTGAAATCAACTTTTTAGGTAAAACTATACTATTAAGAGGGGTTCCAGGTGATGCTCTGAGATATATCAAATGCTCTTAGTGT

Reverse complement sequence

ACACTAAGAGCATTTGATATATCTCAGAGCATCACCTGGAACCCCTCTTAATAGTATAGTTTTACCTAAAAAGTTGATTTCAGAAGATAAACTATCCTAT[A/G]
CACTTCTCGAGTTCCAGTCCGATTTGATTTTGTACTTTTTGGGGGGTCTCCAAGCATCCATCTTCCACACCTTGGACTAATGCACTTGAAAGCTACTCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	32.60%	3.26%	3.83%	NA
All Indica	2759	93.80%	3.40%	1.49%	1.34%	NA
All Japonica	1512	8.30%	91.00%	0.26%	0.46%	NA
Aus	269	30.10%	3.00%	39.03%	27.88%	NA
Indica I	595	93.30%	5.20%	1.18%	0.34%	NA
Indica II	465	95.10%	1.70%	1.51%	1.72%	NA
Indica III	913	95.80%	1.20%	1.42%	1.53%	NA
Indica Intermediate	786	91.00%	5.60%	1.78%	1.65%	NA
Temperate Japonica	767	2.70%	96.50%	0.26%	0.52%	NA
Tropical Japonica	504	17.30%	82.10%	0.20%	0.40%	NA
Japonica Intermediate	241	7.10%	92.10%	0.41%	0.41%	NA
VI/Aromatic	96	16.70%	21.90%	3.12%	58.33%	NA
Intermediate	90	45.60%	46.70%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0615097742	T -> C	LOC_Os06g25840.1	upstream_gene_variant ; 454.0bp to feature; MODIFIER	silent_mutation	Average:21.448; most accessible tissue: Callus, score: 36.05	N	N	N	N
vg0615097742	T -> C	LOC_Os06g25850.1	upstream_gene_variant ; 1264.0bp to feature; MODIFIER	silent_mutation	Average:21.448; most accessible tissue: Callus, score: 36.05	N	N	N	N
vg0615097742	T -> C	LOC_Os06g25840-LOC_Os06g25850	intergenic_region ; MODIFIER	silent_mutation	Average:21.448; most accessible tissue: Callus, score: 36.05	N	N	N	N
vg0615097742	T -> DEL	N	N	silent_mutation	Average:21.448; most accessible tissue: Callus, score: 36.05	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0615097742	NA	4.99E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	2.77E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	3.19E-07	3.19E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	4.52E-06	4.07E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	4.82E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	2.64E-06	3.13E-07	mr1035	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	6.30E-06	6.30E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	7.93E-06	NA	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	8.87E-06	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	8.20E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	2.26E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	6.70E-06	6.70E-06	mr1299	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	1.94E-08	1.13E-08	mr1438	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	1.17E-07	1.17E-07	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	2.85E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	2.83E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	1.68E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	1.70E-06	2.27E-07	mr1626	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	1.30E-06	7.46E-08	mr1631	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	7.86E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	1.26E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	2.79E-07	5.64E-16	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	8.98E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	4.52E-08	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	6.61E-06	NA	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0615097742	NA	1.62E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251