\
| Variant ID: vg0615048049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15048049 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGCAATCGGCTAAGGCAGACAAGAGTTTCTGTTCATCAAAGATTGGGTCCAGTAAATCAAGATCATGGCCAAGAGGACAATGTAATCAGGAAGAATCAAT[G/C]
GTGTCCTTCTAGTATTTTCACGAAGAATCAGAAGAGAAGGGTTCAGAGATTGAGGAACAGGGAGCACCTTCAGGAGGTTGAACAAGAAATTAATCATCGG
CCGATGATTAATTTCTTGTTCAACCTCCTGAAGGTGCTCCCTGTTCCTCAATCTCTGAACCCTTCTCTTCTGATTCTTCGTGAAAATACTAGAAGGACAC[C/G]
ATTGATTCTTCCTGATTACATTGTCCTCTTGGCCATGATCTTGATTTACTGGACCCAATCTTTGATGAACAGAAACTCTTGTCTGCCTTAGCCGATTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 32.30% | 0.68% | 0.68% | NA |
| All Indica | 2759 | 96.60% | 3.20% | 0.18% | 0.04% | NA |
| All Japonica | 1512 | 8.90% | 91.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 5.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.30% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 22.90% | 23.96% | 32.29% | NA |
| Intermediate | 90 | 57.80% | 38.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615048049 | G -> C | LOC_Os06g25760.1 | missense_variant ; p.Trp531Ser; MODERATE | nonsynonymous_codon ; W531S | Average:25.243; most accessible tissue: Minghui63 panicle, score: 53.77 | probably damaging |
2.27 |
DELETERIOUS | 0.00 |
| vg0615048049 | G -> DEL | LOC_Os06g25760.1 | N | frameshift_variant | Average:25.243; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615048049 | NA | 1.82E-23 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 2.80E-06 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 4.26E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 2.20E-16 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | 3.22E-07 | 3.22E-07 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 4.15E-12 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 4.85E-18 | mr1165 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 2.72E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 3.76E-17 | mr1478 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | 1.17E-07 | 1.17E-07 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | 4.79E-07 | 4.79E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 2.47E-22 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 1.28E-07 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 6.20E-16 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615048049 | NA | 4.94E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |