\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614838575:

Variant ID: vg0614838575 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14838575
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCCAACAACAGCGGCATAATAGGCCAGCCGTGCAGGCGGAAACACCAGTCAGCGGCGGACGCTGTGGCCGATCGGTGAAGACGTAGACGCCCAGTAAC[G/A]
ACGGCATAATAGGCCAGTCGTGCAGACGAGGACACCAGTCGGCGGCAACGACGGCAAGCCGGTTGGTGAAGATGTGGACGCCCATCAACGGCGACATAAT

Reverse complement sequence

ATTATGTCGCCGTTGATGGGCGTCCACATCTTCACCAACCGGCTTGCCGTCGTTGCCGCCGACTGGTGTCCTCGTCTGCACGACTGGCCTATTATGCCGT[C/T]
GTTACTGGGCGTCTACGTCTTCACCGATCGGCCACAGCGTCCGCCGCTGACTGGTGTTTCCGCCTGCACGGCTGGCCTATTATGCCGCTGTTGTTGGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 6.80% 0.80% 0.00% NA
All Indica  2759 99.00% 0.70% 0.25% 0.00% NA
All Japonica  1512 86.10% 13.10% 0.79% 0.00% NA
Aus  269 59.10% 34.60% 6.32% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 1.90% 0.51% 0.00% NA
Temperate Japonica  767 98.30% 1.40% 0.26% 0.00% NA
Tropical Japonica  504 63.30% 35.30% 1.39% 0.00% NA
Japonica Intermediate  241 95.00% 3.70% 1.24% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614838575 G -> A LOC_Os06g25320.1 upstream_gene_variant ; 4282.0bp to feature; MODIFIER silent_mutation Average:62.2; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N
vg0614838575 G -> A LOC_Os06g25330.1 downstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:62.2; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N
vg0614838575 G -> A LOC_Os06g25340.1 downstream_gene_variant ; 3352.0bp to feature; MODIFIER silent_mutation Average:62.2; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N
vg0614838575 G -> A LOC_Os06g25330-LOC_Os06g25340 intergenic_region ; MODIFIER silent_mutation Average:62.2; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0614838575 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614838575 NA 3.42E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 6.80E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 3.53E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 1.07E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 1.99E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 2.38E-06 2.75E-08 mr1252_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 1.19E-08 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 6.24E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 4.33E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 7.48E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 3.05E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 2.80E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614838575 NA 2.41E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251