Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614821165:

Variant ID: vg0614821165 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14821165
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GCACTGTGGTAAGTTGTGTTGTGCGAAGGGTATTGTCACGATTTCCCCCTTTGCAGTGCCATGGTGGTACTTCAGGGCATGGCAATATGTGTGGAATCGT[G/A]
TCTTGTGGATACAGTGGTACATCTCTGGCCAAAGTAAAACTATTTGAATAGCCGTGCCCGCGGTTATGGGCAAGTTGAGCAATGTTTTTCGTGATTAGTC

Reverse complement sequence

GACTAATCACGAAAAACATTGCTCAACTTGCCCATAACCGCGGGCACGGCTATTCAAATAGTTTTACTTTGGCCAGAGATGTACCACTGTATCCACAAGA[C/T]
ACGATTCCACACATATTGCCATGCCCTGAAGTACCACCATGGCACTGCAAAGGGGGAAATCGTGACAATACCCTTCGCACAACACAACTTACCACAGTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	27.00%	13.99%	2.12%	NA
All Indica	2759	37.00%	43.50%	16.02%	3.48%	NA
All Japonica	1512	97.90%	1.10%	0.93%	0.07%	NA
Aus	269	17.80%	12.30%	69.14%	0.74%	NA
Indica I	595	17.30%	71.80%	6.22%	4.71%	NA
Indica II	465	20.40%	62.40%	12.90%	4.30%	NA
Indica III	913	59.60%	12.90%	25.41%	2.08%	NA
Indica Intermediate	786	35.40%	46.60%	14.38%	3.69%	NA
Temperate Japonica	767	97.50%	1.40%	1.04%	0.00%	NA
Tropical Japonica	504	98.20%	0.60%	1.19%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	86.50%	10.40%	3.12%	0.00%	NA
Intermediate	90	61.10%	20.00%	17.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614821165	G -> A	LOC_Os06g25300.1	downstream_gene_variant ; 2358.0bp to feature; MODIFIER	silent_mutation	Average:45.396; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0614821165	G -> A	LOC_Os06g25310.1	downstream_gene_variant ; 4394.0bp to feature; MODIFIER	silent_mutation	Average:45.396; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0614821165	G -> A	LOC_Os06g25294-LOC_Os06g25300	intergenic_region ; MODIFIER	silent_mutation	Average:45.396; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0614821165	G -> DEL	N	N	silent_mutation	Average:45.396; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614821165	NA	7.09E-13	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.87E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	6.16E-11	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	1.17E-07	7.09E-47	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	1.78E-07	3.74E-15	mr1091	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.59E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	2.42E-45	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	4.23E-13	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	8.09E-10	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	2.69E-14	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	7.90E-49	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.53E-12	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	4.17E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.77E-08	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.23E-16	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.41E-27	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.28E-08	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.28E-13	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	2.96E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.17E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.79E-13	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	5.63E-52	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.12E-14	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.55E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	9.67E-55	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.13E-15	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	7.02E-11	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	2.13E-20	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	4.02E-60	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.99E-15	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	4.42E-09	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.67E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	6.32E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.91E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	4.86E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	3.11E-28	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614821165	NA	1.85E-09	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251