\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614713753:

Variant ID: vg0614713753 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14713753
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGCTCCCATGCTCCCAGCCTCCTTGATGTTCTTAAAGTACATGTCCGGTGCAGCTCTTAATTTGTCGAAGACTTCAACTGCTTCAACTGTACTTGGAC[C/A]
ATTGTTATTATAAAACATGGCTTGGATCAAAGGAGTGGCAGCATTGGCGACTTCATCTCGCGCCCCTTCAAGCTTCTTAATCTTATTAATCAAGACGTCA

Reverse complement sequence

TGACGTCTTGATTAATAAGATTAAGAAGCTTGAAGGGGCGCGAGATGAAGTCGCCAATGCTGCCACTCCTTTGATCCAAGCCATGTTTTATAATAACAAT[G/T]
GTCCAAGTACAGTTGAAGCAGTTGAAGTCTTCGACAAATTAAGAGCTGCACCGGACATGTACTTTAAGAACATCAAGGAGGCTGGGAGCATGGGAGCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 2.10% 2.62% 26.85% NA
All Indica  2759 53.50% 0.30% 3.66% 42.62% NA
All Japonica  1512 92.20% 5.60% 1.19% 1.06% NA
Aus  269 88.10% 0.00% 0.37% 11.52% NA
Indica I  595 24.20% 0.20% 6.39% 69.24% NA
Indica II  465 34.00% 0.20% 4.09% 61.72% NA
Indica III  913 85.40% 0.10% 1.42% 13.03% NA
Indica Intermediate  786 50.00% 0.50% 3.94% 45.55% NA
Temperate Japonica  767 98.30% 0.10% 0.26% 1.30% NA
Tropical Japonica  504 81.90% 15.10% 2.38% 0.60% NA
Japonica Intermediate  241 94.20% 2.90% 1.66% 1.24% NA
VI/Aromatic  96 69.80% 0.00% 1.04% 29.17% NA
Intermediate  90 66.70% 10.00% 3.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614713753 C -> A LOC_Os06g25150.1 missense_variant ; p.Gly209Cys; MODERATE nonsynonymous_codon ; G209C Average:34.358; most accessible tissue: Minghui63 flag leaf, score: 59.244 probably damaging 3.902 DELETERIOUS 0.00
vg0614713753 C -> DEL LOC_Os06g25150.1 N frameshift_variant Average:34.358; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614713753 NA 5.55E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 3.18E-07 mr1304 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 8.61E-06 2.56E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 1.88E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 6.60E-06 5.65E-09 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 9.88E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 2.62E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 4.59E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 2.66E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614713753 NA 2.72E-10 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251