\
| Variant ID: vg0614713753 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14713753 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )
CTTGCTCCCATGCTCCCAGCCTCCTTGATGTTCTTAAAGTACATGTCCGGTGCAGCTCTTAATTTGTCGAAGACTTCAACTGCTTCAACTGTACTTGGAC[C/A]
ATTGTTATTATAAAACATGGCTTGGATCAAAGGAGTGGCAGCATTGGCGACTTCATCTCGCGCCCCTTCAAGCTTCTTAATCTTATTAATCAAGACGTCA
TGACGTCTTGATTAATAAGATTAAGAAGCTTGAAGGGGCGCGAGATGAAGTCGCCAATGCTGCCACTCCTTTGATCCAAGCCATGTTTTATAATAACAAT[G/T]
GTCCAAGTACAGTTGAAGCAGTTGAAGTCTTCGACAAATTAAGAGCTGCACCGGACATGTACTTTAAGAACATCAAGGAGGCTGGGAGCATGGGAGCAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 2.10% | 2.62% | 26.85% | NA |
| All Indica | 2759 | 53.50% | 0.30% | 3.66% | 42.62% | NA |
| All Japonica | 1512 | 92.20% | 5.60% | 1.19% | 1.06% | NA |
| Aus | 269 | 88.10% | 0.00% | 0.37% | 11.52% | NA |
| Indica I | 595 | 24.20% | 0.20% | 6.39% | 69.24% | NA |
| Indica II | 465 | 34.00% | 0.20% | 4.09% | 61.72% | NA |
| Indica III | 913 | 85.40% | 0.10% | 1.42% | 13.03% | NA |
| Indica Intermediate | 786 | 50.00% | 0.50% | 3.94% | 45.55% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 81.90% | 15.10% | 2.38% | 0.60% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.90% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 69.80% | 0.00% | 1.04% | 29.17% | NA |
| Intermediate | 90 | 66.70% | 10.00% | 3.33% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614713753 | C -> A | LOC_Os06g25150.1 | missense_variant ; p.Gly209Cys; MODERATE | nonsynonymous_codon ; G209C | Average:34.358; most accessible tissue: Minghui63 flag leaf, score: 59.244 | probably damaging |
3.902 |
DELETERIOUS | 0.00 |
| vg0614713753 | C -> DEL | LOC_Os06g25150.1 | N | frameshift_variant | Average:34.358; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614713753 | NA | 5.55E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 3.18E-07 | mr1304 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | 8.61E-06 | 2.56E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 1.88E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | 6.60E-06 | 5.65E-09 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 9.88E-06 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 2.62E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 4.59E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 2.66E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614713753 | NA | 2.72E-10 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |